\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322355733:

Variant ID: vg0322355733 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22355733
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.78, T: 0.22, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAATTCGTATCGCGATTTACTAACGGACTCTGTAATTAGTTTTTTTATTAGTGCCCGAACACCCTCGTGTGATATTCTATATAGTAATACCTGATGTG[A/T]
CACCGGAAATTTACATCCTGGATCTAATTTCGCTAAATCCAAAAGTCAAATTTCGCTAGCTCTAAAAGTCAAATTTACACCCTGGATCTAATTTTTAAAC

Reverse complement sequence

GTTTAAAAATTAGATCCAGGGTGTAAATTTGACTTTTAGAGCTAGCGAAATTTGACTTTTGGATTTAGCGAAATTAGATCCAGGATGTAAATTTCCGGTG[T/A]
CACATCAGGTATTACTATATAGAATATCACACGAGGGTGTTCGGGCACTAATAAAAAAACTAATTACAGAGTCCGTTAGTAAATCGCGATACGAATTTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 41.00% 0.23% 0.00% NA
All Indica  2759 41.20% 58.50% 0.36% 0.00% NA
All Japonica  1512 98.20% 1.80% 0.00% 0.00% NA
Aus  269 25.30% 74.70% 0.00% 0.00% NA
Indica I  595 14.30% 85.50% 0.17% 0.00% NA
Indica II  465 82.60% 17.00% 0.43% 0.00% NA
Indica III  913 35.90% 63.60% 0.44% 0.00% NA
Indica Intermediate  786 43.10% 56.50% 0.38% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 95.80% 4.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 26.00% 74.00% 0.00% 0.00% NA
Intermediate  90 67.80% 31.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322355733 A -> T LOC_Os03g40194.1 upstream_gene_variant ; 4209.0bp to feature; MODIFIER silent_mutation Average:87.426; most accessible tissue: Callus, score: 98.288 N N N N
vg0322355733 A -> T LOC_Os03g40210.1 upstream_gene_variant ; 857.0bp to feature; MODIFIER silent_mutation Average:87.426; most accessible tissue: Callus, score: 98.288 N N N N
vg0322355733 A -> T LOC_Os03g40220.1 downstream_gene_variant ; 1989.0bp to feature; MODIFIER silent_mutation Average:87.426; most accessible tissue: Callus, score: 98.288 N N N N
vg0322355733 A -> T LOC_Os03g40210-LOC_Os03g40220 intergenic_region ; MODIFIER silent_mutation Average:87.426; most accessible tissue: Callus, score: 98.288 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0322355733 A T -0.01 -0.05 -0.04 -0.02 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322355733 NA 2.13E-28 Grain_length Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0322355733 NA 2.39E-10 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0322355733 NA 1.07E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322355733 NA 5.73E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322355733 NA 7.01E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322355733 NA 7.17E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322355733 NA 9.29E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322355733 NA 1.68E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322355733 NA 7.23E-06 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322355733 NA 3.44E-07 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322355733 NA 1.57E-08 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322355733 NA 5.10E-07 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322355733 NA 1.00E-09 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322355733 NA 4.25E-17 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322355733 NA 1.19E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251