\
| Variant ID: vg0322179197 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22179197 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 103. )
ACTGACGGGCTGAAAACGGAGGTCGTATGGAGATTCGGCGGCCGTTTGAAGTCAGCAGTGTAGTAGGTGGCCGAATCGGATTCCAGCACTTGGAGGACTT[A/G]
AACTTGATATCTTGTTGTTCATCCATGATGTGAGCAACGGATGTATCCGTAGTAGCCATGGTCACATCAAGAACCTTGCCGGAGCCAGATCATCGGTCAG
CTGACCGATGATCTGGCTCCGGCAAGGTTCTTGATGTGACCATGGCTACTACGGATACATCCGTTGCTCACATCATGGATGAACAACAAGATATCAAGTT[T/C]
AAGTCCTCCAAGTGCTGGAATCCGATTCGGCCACCTACTACACTGCTGACTTCAAACGGCCGCCGAATCTCCATACGACCTCCGTTTTCAGCCCGTCAGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.30% | 18.10% | 8.15% | 33.45% | NA |
| All Indica | 2759 | 17.40% | 16.20% | 12.21% | 54.22% | NA |
| All Japonica | 1512 | 90.00% | 8.30% | 0.07% | 1.65% | NA |
| Aus | 269 | 4.80% | 72.10% | 12.27% | 10.78% | NA |
| Indica I | 595 | 7.40% | 48.60% | 14.96% | 29.08% | NA |
| Indica II | 465 | 14.80% | 4.70% | 9.25% | 71.18% | NA |
| Indica III | 913 | 28.10% | 1.10% | 13.69% | 57.06% | NA |
| Indica Intermediate | 786 | 14.00% | 15.90% | 10.18% | 59.92% | NA |
| Temperate Japonica | 767 | 97.30% | 2.60% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 90.70% | 4.40% | 0.20% | 4.76% | NA |
| Japonica Intermediate | 241 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 80.20% | 7.29% | 9.38% | NA |
| Intermediate | 90 | 51.10% | 16.70% | 7.78% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322179197 | A -> DEL | N | N | silent_mutation | Average:27.616; most accessible tissue: Callus, score: 77.14 | N | N | N | N |
| vg0322179197 | A -> G | LOC_Os03g39890.1 | upstream_gene_variant ; 2084.0bp to feature; MODIFIER | silent_mutation | Average:27.616; most accessible tissue: Callus, score: 77.14 | N | N | N | N |
| vg0322179197 | A -> G | LOC_Os03g39900.1 | upstream_gene_variant ; 58.0bp to feature; MODIFIER | silent_mutation | Average:27.616; most accessible tissue: Callus, score: 77.14 | N | N | N | N |
| vg0322179197 | A -> G | LOC_Os03g39880.1 | downstream_gene_variant ; 4248.0bp to feature; MODIFIER | silent_mutation | Average:27.616; most accessible tissue: Callus, score: 77.14 | N | N | N | N |
| vg0322179197 | A -> G | LOC_Os03g39890-LOC_Os03g39900 | intergenic_region ; MODIFIER | silent_mutation | Average:27.616; most accessible tissue: Callus, score: 77.14 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322179197 | NA | 5.65E-09 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322179197 | NA | 1.87E-06 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322179197 | NA | 6.31E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322179197 | 1.92E-06 | NA | mr1612 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322179197 | NA | 8.78E-07 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322179197 | NA | 1.31E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322179197 | NA | 4.11E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322179197 | NA | 4.11E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322179197 | NA | 1.38E-10 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322179197 | 5.71E-06 | 5.70E-06 | mr1312_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |