\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322179197:

Variant ID: vg0322179197 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22179197
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


ACTGACGGGCTGAAAACGGAGGTCGTATGGAGATTCGGCGGCCGTTTGAAGTCAGCAGTGTAGTAGGTGGCCGAATCGGATTCCAGCACTTGGAGGACTT[A/G]
AACTTGATATCTTGTTGTTCATCCATGATGTGAGCAACGGATGTATCCGTAGTAGCCATGGTCACATCAAGAACCTTGCCGGAGCCAGATCATCGGTCAG

Reverse complement sequence

CTGACCGATGATCTGGCTCCGGCAAGGTTCTTGATGTGACCATGGCTACTACGGATACATCCGTTGCTCACATCATGGATGAACAACAAGATATCAAGTT[T/C]
AAGTCCTCCAAGTGCTGGAATCCGATTCGGCCACCTACTACACTGCTGACTTCAAACGGCCGCCGAATCTCCATACGACCTCCGTTTTCAGCCCGTCAGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.30% 18.10% 8.15% 33.45% NA
All Indica  2759 17.40% 16.20% 12.21% 54.22% NA
All Japonica  1512 90.00% 8.30% 0.07% 1.65% NA
Aus  269 4.80% 72.10% 12.27% 10.78% NA
Indica I  595 7.40% 48.60% 14.96% 29.08% NA
Indica II  465 14.80% 4.70% 9.25% 71.18% NA
Indica III  913 28.10% 1.10% 13.69% 57.06% NA
Indica Intermediate  786 14.00% 15.90% 10.18% 59.92% NA
Temperate Japonica  767 97.30% 2.60% 0.00% 0.13% NA
Tropical Japonica  504 90.70% 4.40% 0.20% 4.76% NA
Japonica Intermediate  241 65.60% 34.40% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 80.20% 7.29% 9.38% NA
Intermediate  90 51.10% 16.70% 7.78% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322179197 A -> DEL N N silent_mutation Average:27.616; most accessible tissue: Callus, score: 77.14 N N N N
vg0322179197 A -> G LOC_Os03g39890.1 upstream_gene_variant ; 2084.0bp to feature; MODIFIER silent_mutation Average:27.616; most accessible tissue: Callus, score: 77.14 N N N N
vg0322179197 A -> G LOC_Os03g39900.1 upstream_gene_variant ; 58.0bp to feature; MODIFIER silent_mutation Average:27.616; most accessible tissue: Callus, score: 77.14 N N N N
vg0322179197 A -> G LOC_Os03g39880.1 downstream_gene_variant ; 4248.0bp to feature; MODIFIER silent_mutation Average:27.616; most accessible tissue: Callus, score: 77.14 N N N N
vg0322179197 A -> G LOC_Os03g39890-LOC_Os03g39900 intergenic_region ; MODIFIER silent_mutation Average:27.616; most accessible tissue: Callus, score: 77.14 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322179197 NA 5.65E-09 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322179197 NA 1.87E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322179197 NA 6.31E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322179197 1.92E-06 NA mr1612 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322179197 NA 8.78E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322179197 NA 1.31E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322179197 NA 4.11E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322179197 NA 4.11E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322179197 NA 1.38E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322179197 5.71E-06 5.70E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251