Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322174837:

Variant ID: vg0322174837 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 22174837
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.71, A: 0.29, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

GGAAGCTGTGCATCCTGCCCCTTCTGACACAAAAAAGGTCTCACCTATCCTGTTCTTATTCATATTGACACTTTGCAAGACCTGGTGTCCCGACAGGTCC[G/A]
CTGCTTCCAGTGGCGTTATGGAGTAGCAGATGATGTTGCAAGAACCAGGGTAATTGCTTTACCCCTCCAAGCCTGCAGAACTGATGAACCCTGAGTTCCT

Reverse complement sequence

AGGAACTCAGGGTTCATCAGTTCTGCAGGCTTGGAGGGGTAAAGCAATTACCCTGGTTCTTGCAACATCATCTGCTACTCCATAACGCCACTGGAAGCAG[C/T]
GGACCTGTCGGGACACCAGGTCTTGCAAAGTGTCAATATGAATAAGAACAGGATAGGTGAGACCTTTTTTGTGTCAGAAGGGGCAGGATGCACAGCTTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.80%	4.00%	1.04%	46.19%	NA
All Indica	2759	21.80%	0.70%	1.41%	76.11%	NA
All Japonica	1512	89.20%	9.80%	0.46%	0.60%	NA
Aus	269	75.10%	7.80%	0.37%	16.73%	NA
Indica I	595	52.80%	0.00%	0.84%	46.39%	NA
Indica II	465	9.00%	0.20%	1.51%	89.25%	NA
Indica III	913	7.70%	1.10%	1.64%	89.59%	NA
Indica Intermediate	786	22.40%	0.90%	1.53%	75.19%	NA
Temperate Japonica	767	95.40%	3.80%	0.78%	0.00%	NA
Tropical Japonica	504	90.50%	7.70%	0.20%	1.59%	NA
Japonica Intermediate	241	66.40%	33.20%	0.00%	0.41%	NA
VI/Aromatic	96	96.90%	1.00%	0.00%	2.08%	NA
Intermediate	90	66.70%	1.10%	2.22%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0322174837	G -> A	LOC_Os03g39880.1	3_prime_UTR_variant ; 501.0bp to feature; MODIFIER	silent_mutation	Average:35.528; most accessible tissue: Callus, score: 68.661	N	N	N	N
vg0322174837	G -> A	LOC_Os03g39860.1	upstream_gene_variant ; 4918.0bp to feature; MODIFIER	silent_mutation	Average:35.528; most accessible tissue: Callus, score: 68.661	N	N	N	N
vg0322174837	G -> A	LOC_Os03g39870.1	upstream_gene_variant ; 790.0bp to feature; MODIFIER	silent_mutation	Average:35.528; most accessible tissue: Callus, score: 68.661	N	N	N	N
vg0322174837	G -> A	LOC_Os03g39900.1	upstream_gene_variant ; 4418.0bp to feature; MODIFIER	silent_mutation	Average:35.528; most accessible tissue: Callus, score: 68.661	N	N	N	N
vg0322174837	G -> A	LOC_Os03g39860.2	upstream_gene_variant ; 4918.0bp to feature; MODIFIER	silent_mutation	Average:35.528; most accessible tissue: Callus, score: 68.661	N	N	N	N
vg0322174837	G -> A	LOC_Os03g39890.1	downstream_gene_variant ; 494.0bp to feature; MODIFIER	silent_mutation	Average:35.528; most accessible tissue: Callus, score: 68.661	N	N	N	N
vg0322174837	G -> DEL	N	N	silent_mutation	Average:35.528; most accessible tissue: Callus, score: 68.661	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0322174837	4.84E-07	4.84E-07	mr1312_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322174837	6.10E-06	6.10E-06	mr1663_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322174837	8.71E-07	8.71E-07	mr1669_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322174837	NA	7.37E-06	mr1682_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322174837	NA	3.46E-06	mr1683_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322174837	1.44E-06	1.44E-06	mr1822_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322174837	3.00E-06	3.00E-06	mr1832_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322174837	NA	3.15E-06	mr1833_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251