\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322174837:

Variant ID: vg0322174837 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22174837
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.71, A: 0.29, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAGCTGTGCATCCTGCCCCTTCTGACACAAAAAAGGTCTCACCTATCCTGTTCTTATTCATATTGACACTTTGCAAGACCTGGTGTCCCGACAGGTCC[G/A]
CTGCTTCCAGTGGCGTTATGGAGTAGCAGATGATGTTGCAAGAACCAGGGTAATTGCTTTACCCCTCCAAGCCTGCAGAACTGATGAACCCTGAGTTCCT

Reverse complement sequence

AGGAACTCAGGGTTCATCAGTTCTGCAGGCTTGGAGGGGTAAAGCAATTACCCTGGTTCTTGCAACATCATCTGCTACTCCATAACGCCACTGGAAGCAG[C/T]
GGACCTGTCGGGACACCAGGTCTTGCAAAGTGTCAATATGAATAAGAACAGGATAGGTGAGACCTTTTTTGTGTCAGAAGGGGCAGGATGCACAGCTTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.80% 4.00% 1.04% 46.19% NA
All Indica  2759 21.80% 0.70% 1.41% 76.11% NA
All Japonica  1512 89.20% 9.80% 0.46% 0.60% NA
Aus  269 75.10% 7.80% 0.37% 16.73% NA
Indica I  595 52.80% 0.00% 0.84% 46.39% NA
Indica II  465 9.00% 0.20% 1.51% 89.25% NA
Indica III  913 7.70% 1.10% 1.64% 89.59% NA
Indica Intermediate  786 22.40% 0.90% 1.53% 75.19% NA
Temperate Japonica  767 95.40% 3.80% 0.78% 0.00% NA
Tropical Japonica  504 90.50% 7.70% 0.20% 1.59% NA
Japonica Intermediate  241 66.40% 33.20% 0.00% 0.41% NA
VI/Aromatic  96 96.90% 1.00% 0.00% 2.08% NA
Intermediate  90 66.70% 1.10% 2.22% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322174837 G -> A LOC_Os03g39880.1 3_prime_UTR_variant ; 501.0bp to feature; MODIFIER silent_mutation Average:35.528; most accessible tissue: Callus, score: 68.661 N N N N
vg0322174837 G -> A LOC_Os03g39860.1 upstream_gene_variant ; 4918.0bp to feature; MODIFIER silent_mutation Average:35.528; most accessible tissue: Callus, score: 68.661 N N N N
vg0322174837 G -> A LOC_Os03g39870.1 upstream_gene_variant ; 790.0bp to feature; MODIFIER silent_mutation Average:35.528; most accessible tissue: Callus, score: 68.661 N N N N
vg0322174837 G -> A LOC_Os03g39900.1 upstream_gene_variant ; 4418.0bp to feature; MODIFIER silent_mutation Average:35.528; most accessible tissue: Callus, score: 68.661 N N N N
vg0322174837 G -> A LOC_Os03g39860.2 upstream_gene_variant ; 4918.0bp to feature; MODIFIER silent_mutation Average:35.528; most accessible tissue: Callus, score: 68.661 N N N N
vg0322174837 G -> A LOC_Os03g39890.1 downstream_gene_variant ; 494.0bp to feature; MODIFIER silent_mutation Average:35.528; most accessible tissue: Callus, score: 68.661 N N N N
vg0322174837 G -> DEL N N silent_mutation Average:35.528; most accessible tissue: Callus, score: 68.661 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322174837 4.84E-07 4.84E-07 mr1312_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322174837 6.10E-06 6.10E-06 mr1663_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322174837 8.71E-07 8.71E-07 mr1669_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322174837 NA 7.37E-06 mr1682_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322174837 NA 3.46E-06 mr1683_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322174837 1.44E-06 1.44E-06 mr1822_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322174837 3.00E-06 3.00E-06 mr1832_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322174837 NA 3.15E-06 mr1833_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251