\
| Variant ID: vg0322174837 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22174837 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.71, A: 0.29, others allele: 0.00, population size: 213. )
GGAAGCTGTGCATCCTGCCCCTTCTGACACAAAAAAGGTCTCACCTATCCTGTTCTTATTCATATTGACACTTTGCAAGACCTGGTGTCCCGACAGGTCC[G/A]
CTGCTTCCAGTGGCGTTATGGAGTAGCAGATGATGTTGCAAGAACCAGGGTAATTGCTTTACCCCTCCAAGCCTGCAGAACTGATGAACCCTGAGTTCCT
AGGAACTCAGGGTTCATCAGTTCTGCAGGCTTGGAGGGGTAAAGCAATTACCCTGGTTCTTGCAACATCATCTGCTACTCCATAACGCCACTGGAAGCAG[C/T]
GGACCTGTCGGGACACCAGGTCTTGCAAAGTGTCAATATGAATAAGAACAGGATAGGTGAGACCTTTTTTGTGTCAGAAGGGGCAGGATGCACAGCTTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.80% | 4.00% | 1.04% | 46.19% | NA |
| All Indica | 2759 | 21.80% | 0.70% | 1.41% | 76.11% | NA |
| All Japonica | 1512 | 89.20% | 9.80% | 0.46% | 0.60% | NA |
| Aus | 269 | 75.10% | 7.80% | 0.37% | 16.73% | NA |
| Indica I | 595 | 52.80% | 0.00% | 0.84% | 46.39% | NA |
| Indica II | 465 | 9.00% | 0.20% | 1.51% | 89.25% | NA |
| Indica III | 913 | 7.70% | 1.10% | 1.64% | 89.59% | NA |
| Indica Intermediate | 786 | 22.40% | 0.90% | 1.53% | 75.19% | NA |
| Temperate Japonica | 767 | 95.40% | 3.80% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 90.50% | 7.70% | 0.20% | 1.59% | NA |
| Japonica Intermediate | 241 | 66.40% | 33.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 66.70% | 1.10% | 2.22% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322174837 | G -> A | LOC_Os03g39880.1 | 3_prime_UTR_variant ; 501.0bp to feature; MODIFIER | silent_mutation | Average:35.528; most accessible tissue: Callus, score: 68.661 | N | N | N | N |
| vg0322174837 | G -> A | LOC_Os03g39860.1 | upstream_gene_variant ; 4918.0bp to feature; MODIFIER | silent_mutation | Average:35.528; most accessible tissue: Callus, score: 68.661 | N | N | N | N |
| vg0322174837 | G -> A | LOC_Os03g39870.1 | upstream_gene_variant ; 790.0bp to feature; MODIFIER | silent_mutation | Average:35.528; most accessible tissue: Callus, score: 68.661 | N | N | N | N |
| vg0322174837 | G -> A | LOC_Os03g39900.1 | upstream_gene_variant ; 4418.0bp to feature; MODIFIER | silent_mutation | Average:35.528; most accessible tissue: Callus, score: 68.661 | N | N | N | N |
| vg0322174837 | G -> A | LOC_Os03g39860.2 | upstream_gene_variant ; 4918.0bp to feature; MODIFIER | silent_mutation | Average:35.528; most accessible tissue: Callus, score: 68.661 | N | N | N | N |
| vg0322174837 | G -> A | LOC_Os03g39890.1 | downstream_gene_variant ; 494.0bp to feature; MODIFIER | silent_mutation | Average:35.528; most accessible tissue: Callus, score: 68.661 | N | N | N | N |
| vg0322174837 | G -> DEL | N | N | silent_mutation | Average:35.528; most accessible tissue: Callus, score: 68.661 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322174837 | 4.84E-07 | 4.84E-07 | mr1312_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322174837 | 6.10E-06 | 6.10E-06 | mr1663_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322174837 | 8.71E-07 | 8.71E-07 | mr1669_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322174837 | NA | 7.37E-06 | mr1682_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322174837 | NA | 3.46E-06 | mr1683_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322174837 | 1.44E-06 | 1.44E-06 | mr1822_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322174837 | 3.00E-06 | 3.00E-06 | mr1832_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322174837 | NA | 3.15E-06 | mr1833_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |