\
| Variant ID: vg0322159734 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22159734 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATTTGTGTGTGGATTTGGATGTTACTTTGATTTGGGATTTGGGGTTTAATTTAGGGATATGCATACCACTTGATTCGGGAGAAAATAAAAAAGAAAAAAA[G/A]
AAGAAGAAAGGGGACCATCTGTTATCCCTCTTTAGTCCCTCACCAACCGGGACTAAAGATACCGGGACTAAAGATCGATCTGGTTATTTCACCCGGGATT
AATCCCGGGTGAAATAACCAGATCGATCTTTAGTCCCGGTATCTTTAGTCCCGGTTGGTGAGGGACTAAAGAGGGATAACAGATGGTCCCCTTTCTTCTT[C/T]
TTTTTTTCTTTTTTATTTTCTCCCGAATCAAGTGGTATGCATATCCCTAAATTAAACCCCAAATCCCAAATCAAAGTAACATCCAAATCCACACACAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.90% | 8.00% | 0.13% | 0.02% | NA |
| All Indica | 2759 | 86.30% | 13.50% | 0.22% | 0.04% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 53.80% | 45.90% | 0.34% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 99.30% | 0.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 89.40% | 10.20% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322159734 | G -> A | LOC_Os03g39850.1 | downstream_gene_variant ; 512.0bp to feature; MODIFIER | silent_mutation | Average:47.0; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| vg0322159734 | G -> A | LOC_Os03g39860.1 | downstream_gene_variant ; 4867.0bp to feature; MODIFIER | silent_mutation | Average:47.0; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| vg0322159734 | G -> A | LOC_Os03g39860.2 | downstream_gene_variant ; 4878.0bp to feature; MODIFIER | silent_mutation | Average:47.0; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| vg0322159734 | G -> A | LOC_Os03g39830-LOC_Os03g39850 | intergenic_region ; MODIFIER | silent_mutation | Average:47.0; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| vg0322159734 | G -> DEL | N | N | silent_mutation | Average:47.0; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322159734 | 5.50E-06 | NA | mr1387 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322159734 | 5.60E-06 | 5.60E-06 | mr1694 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322159734 | NA | 6.76E-06 | mr1772 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322159734 | 9.18E-06 | NA | mr1243_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322159734 | 6.55E-07 | NA | mr1730_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322159734 | 7.70E-06 | NA | mr1818_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |