\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322159734:

Variant ID: vg0322159734 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22159734
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTGTGTGTGGATTTGGATGTTACTTTGATTTGGGATTTGGGGTTTAATTTAGGGATATGCATACCACTTGATTCGGGAGAAAATAAAAAAGAAAAAAA[G/A]
AAGAAGAAAGGGGACCATCTGTTATCCCTCTTTAGTCCCTCACCAACCGGGACTAAAGATACCGGGACTAAAGATCGATCTGGTTATTTCACCCGGGATT

Reverse complement sequence

AATCCCGGGTGAAATAACCAGATCGATCTTTAGTCCCGGTATCTTTAGTCCCGGTTGGTGAGGGACTAAAGAGGGATAACAGATGGTCCCCTTTCTTCTT[C/T]
TTTTTTTCTTTTTTATTTTCTCCCGAATCAAGTGGTATGCATATCCCTAAATTAAACCCCAAATCCCAAATCAAAGTAACATCCAAATCCACACACAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 8.00% 0.13% 0.02% NA
All Indica  2759 86.30% 13.50% 0.22% 0.04% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 53.80% 45.90% 0.34% 0.00% NA
Indica II  465 96.80% 3.00% 0.00% 0.22% NA
Indica III  913 99.30% 0.50% 0.11% 0.00% NA
Indica Intermediate  786 89.40% 10.20% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322159734 G -> A LOC_Os03g39850.1 downstream_gene_variant ; 512.0bp to feature; MODIFIER silent_mutation Average:47.0; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0322159734 G -> A LOC_Os03g39860.1 downstream_gene_variant ; 4867.0bp to feature; MODIFIER silent_mutation Average:47.0; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0322159734 G -> A LOC_Os03g39860.2 downstream_gene_variant ; 4878.0bp to feature; MODIFIER silent_mutation Average:47.0; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0322159734 G -> A LOC_Os03g39830-LOC_Os03g39850 intergenic_region ; MODIFIER silent_mutation Average:47.0; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0322159734 G -> DEL N N silent_mutation Average:47.0; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322159734 5.50E-06 NA mr1387 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322159734 5.60E-06 5.60E-06 mr1694 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322159734 NA 6.76E-06 mr1772 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322159734 9.18E-06 NA mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322159734 6.55E-07 NA mr1730_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322159734 7.70E-06 NA mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251