RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0322154741:

Variant ID: vg0322154741 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 22154741
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

AGGAGTATGCCATCGTGCACCATCGTCCATATCGTGTTGTCAATTCTGCCGCAAATAGGAGGTACACTGTTAAATGTGAAAACCCACGGTGCAAATGGAA[G/A]
GTCCATGCAACTAAGAGGTCTAGTGGCACGTGGAGGATATCACAGGTTGGTAAGGCACATAGTTGTGCTGCTGCCGAAGGTTCAAGGAGCCACCGGCAGC

Reverse complement sequence

GCTGCCGGTGGCTCCTTGAACCTTCGGCAGCAGCACAACTATGTGCCTTACCAACCTGTGATATCCTCCACGTGCCACTAGACCTCTTAGTTGCATGGAC[C/T]
TTCCATTTGCACCGTGGGTTTTCACATTTAACAGTGTACCTCCTATTTGCGGCAGAATTGACAACACGATATGGACGATGGTGCACGATGGCATACTCCT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.50%	36.40%	0.08%	0.00%	NA
All Indica	2759	97.30%	2.60%	0.11%	0.00%	NA
All Japonica	1512	2.00%	98.00%	0.00%	0.00%	NA
Aus	269	90.70%	9.30%	0.00%	0.00%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	97.50%	2.30%	0.22%	0.00%	NA
Indica Intermediate	786	96.40%	3.40%	0.13%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	5.00%	95.00%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	43.30%	55.60%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0322154741	G -> A	LOC_Os03g39830.1	upstream_gene_variant ; 3129.0bp to feature; MODIFIER	silent_mutation	Average:35.516; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg0322154741	G -> A	LOC_Os03g39820.1	downstream_gene_variant ; 4768.0bp to feature; MODIFIER	silent_mutation	Average:35.516; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg0322154741	G -> A	LOC_Os03g39830-LOC_Os03g39850	intergenic_region ; MODIFIER	silent_mutation	Average:35.516; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0322154741	NA	7.36E-16	mr1156	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322154741	2.58E-10	1.00E-84	mr1718	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322154741	3.24E-06	2.57E-10	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322154741	NA	3.66E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322154741	NA	4.66E-114	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322154741	NA	8.41E-10	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322154741	NA	8.63E-16	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322154741	NA	4.26E-14	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322154741	5.10E-06	NA	mr1718_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322154741	NA	6.19E-13	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 10 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0322154741:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact