\
| Variant ID: vg0322154741 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22154741 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 254. )
AGGAGTATGCCATCGTGCACCATCGTCCATATCGTGTTGTCAATTCTGCCGCAAATAGGAGGTACACTGTTAAATGTGAAAACCCACGGTGCAAATGGAA[G/A]
GTCCATGCAACTAAGAGGTCTAGTGGCACGTGGAGGATATCACAGGTTGGTAAGGCACATAGTTGTGCTGCTGCCGAAGGTTCAAGGAGCCACCGGCAGC
GCTGCCGGTGGCTCCTTGAACCTTCGGCAGCAGCACAACTATGTGCCTTACCAACCTGTGATATCCTCCACGTGCCACTAGACCTCTTAGTTGCATGGAC[C/T]
TTCCATTTGCACCGTGGGTTTTCACATTTAACAGTGTACCTCCTATTTGCGGCAGAATTGACAACACGATATGGACGATGGTGCACGATGGCATACTCCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.50% | 36.40% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 97.30% | 2.60% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 90.70% | 9.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.50% | 2.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 96.40% | 3.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 55.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322154741 | G -> A | LOC_Os03g39830.1 | upstream_gene_variant ; 3129.0bp to feature; MODIFIER | silent_mutation | Average:35.516; most accessible tissue: Minghui63 flag leaf, score: 56.489 | N | N | N | N |
| vg0322154741 | G -> A | LOC_Os03g39820.1 | downstream_gene_variant ; 4768.0bp to feature; MODIFIER | silent_mutation | Average:35.516; most accessible tissue: Minghui63 flag leaf, score: 56.489 | N | N | N | N |
| vg0322154741 | G -> A | LOC_Os03g39830-LOC_Os03g39850 | intergenic_region ; MODIFIER | silent_mutation | Average:35.516; most accessible tissue: Minghui63 flag leaf, score: 56.489 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322154741 | NA | 7.36E-16 | mr1156 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322154741 | 2.58E-10 | 1.00E-84 | mr1718 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322154741 | 3.24E-06 | 2.57E-10 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322154741 | NA | 3.66E-13 | mr1740 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322154741 | NA | 4.66E-114 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322154741 | NA | 8.41E-10 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322154741 | NA | 8.63E-16 | mr1842 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322154741 | NA | 4.26E-14 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322154741 | 5.10E-06 | NA | mr1718_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322154741 | NA | 6.19E-13 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |