\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322154741:

Variant ID: vg0322154741 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22154741
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


AGGAGTATGCCATCGTGCACCATCGTCCATATCGTGTTGTCAATTCTGCCGCAAATAGGAGGTACACTGTTAAATGTGAAAACCCACGGTGCAAATGGAA[G/A]
GTCCATGCAACTAAGAGGTCTAGTGGCACGTGGAGGATATCACAGGTTGGTAAGGCACATAGTTGTGCTGCTGCCGAAGGTTCAAGGAGCCACCGGCAGC

Reverse complement sequence

GCTGCCGGTGGCTCCTTGAACCTTCGGCAGCAGCACAACTATGTGCCTTACCAACCTGTGATATCCTCCACGTGCCACTAGACCTCTTAGTTGCATGGAC[C/T]
TTCCATTTGCACCGTGGGTTTTCACATTTAACAGTGTACCTCCTATTTGCGGCAGAATTGACAACACGATATGGACGATGGTGCACGATGGCATACTCCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.50% 36.40% 0.08% 0.00% NA
All Indica  2759 97.30% 2.60% 0.11% 0.00% NA
All Japonica  1512 2.00% 98.00% 0.00% 0.00% NA
Aus  269 90.70% 9.30% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 97.50% 2.30% 0.22% 0.00% NA
Indica Intermediate  786 96.40% 3.40% 0.13% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 5.00% 95.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 43.30% 55.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322154741 G -> A LOC_Os03g39830.1 upstream_gene_variant ; 3129.0bp to feature; MODIFIER silent_mutation Average:35.516; most accessible tissue: Minghui63 flag leaf, score: 56.489 N N N N
vg0322154741 G -> A LOC_Os03g39820.1 downstream_gene_variant ; 4768.0bp to feature; MODIFIER silent_mutation Average:35.516; most accessible tissue: Minghui63 flag leaf, score: 56.489 N N N N
vg0322154741 G -> A LOC_Os03g39830-LOC_Os03g39850 intergenic_region ; MODIFIER silent_mutation Average:35.516; most accessible tissue: Minghui63 flag leaf, score: 56.489 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322154741 NA 7.36E-16 mr1156 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322154741 2.58E-10 1.00E-84 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322154741 3.24E-06 2.57E-10 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322154741 NA 3.66E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322154741 NA 4.66E-114 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322154741 NA 8.41E-10 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322154741 NA 8.63E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322154741 NA 4.26E-14 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322154741 5.10E-06 NA mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322154741 NA 6.19E-13 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251