\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322099539:

Variant ID: vg0322099539 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22099539
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CAACCGCACCAACTTACAAAACCAGTGCAAATCAGGTCTCTTAGCGGTTTTGACCCCGGTTTTGTCTGACGTGGCGGCTGAGTCATCGTAGGACCTACGT[A/G]
GGCCCCACATGTCAGGATGCCACATCAGCAGACCGGCCTCTCCCCTTCCTCTCCTTTCCTCCTCTCTCTCTCTCTCTCACTCCTCTCAGGACTCGTCCGA

Reverse complement sequence

TCGGACGAGTCCTGAGAGGAGTGAGAGAGAGAGAGAGAGGAGGAAAGGAGAGGAAGGGGAGAGGCCGGTCTGCTGATGTGGCATCCTGACATGTGGGGCC[T/C]
ACGTAGGTCCTACGATGACTCAGCCGCCACGTCAGACAAAACCGGGGTCAAAACCGCTAAGAGACCTGATTTGCACTGGTTTTGTAAGTTGGTGCGGTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.90% 2.60% 38.43% 25.14% NA
All Indica  2759 2.40% 4.00% 55.09% 38.46% NA
All Japonica  1512 92.30% 0.20% 1.98% 5.56% NA
Aus  269 0.70% 2.20% 88.10% 8.92% NA
Indica I  595 1.80% 3.20% 65.55% 29.41% NA
Indica II  465 3.00% 3.90% 32.47% 60.65% NA
Indica III  913 1.50% 5.70% 60.79% 31.98% NA
Indica Intermediate  786 3.60% 2.80% 53.94% 39.69% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 78.80% 0.60% 5.75% 14.88% NA
Japonica Intermediate  241 97.10% 0.00% 0.41% 2.49% NA
VI/Aromatic  96 91.70% 1.00% 5.21% 2.08% NA
Intermediate  90 54.40% 0.00% 26.67% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322099539 A -> DEL N N silent_mutation Average:95.346; most accessible tissue: Minghui63 panicle, score: 97.58 N N N N
vg0322099539 A -> G LOC_Os03g39710.1 upstream_gene_variant ; 4167.0bp to feature; MODIFIER silent_mutation Average:95.346; most accessible tissue: Minghui63 panicle, score: 97.58 N N N N
vg0322099539 A -> G LOC_Os03g39720.1 upstream_gene_variant ; 122.0bp to feature; MODIFIER silent_mutation Average:95.346; most accessible tissue: Minghui63 panicle, score: 97.58 N N N N
vg0322099539 A -> G LOC_Os03g39730.1 downstream_gene_variant ; 4211.0bp to feature; MODIFIER silent_mutation Average:95.346; most accessible tissue: Minghui63 panicle, score: 97.58 N N N N
vg0322099539 A -> G LOC_Os03g39710-LOC_Os03g39720 intergenic_region ; MODIFIER silent_mutation Average:95.346; most accessible tissue: Minghui63 panicle, score: 97.58 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0322099539 A G 0.04 0.16 0.16 0.1 0.11 0.15

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322099539 NA 1.18E-69 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 1.29E-19 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 5.85E-44 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 6.92E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 3.70E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 3.74E-34 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 1.10E-60 mr1711 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 2.86E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 4.25E-09 1.41E-87 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 3.42E-22 1.46E-165 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 8.97E-35 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 2.85E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 1.10E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 4.64E-41 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 1.22E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 6.27E-56 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 1.62E-71 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 2.62E-24 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 3.75E-82 mr1907 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 2.78E-33 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 3.33E-75 mr1934 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 2.30E-53 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 1.27E-33 mr1944 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 4.09E-06 9.53E-115 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 2.64E-30 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 2.55E-24 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 1.53E-13 2.28E-126 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 2.30E-30 1.50E-222 mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 1.92E-68 mr1828_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 1.31E-69 mr1889_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 8.53E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 2.24E-66 mr1896_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 2.55E-96 mr1907_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 2.92E-22 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 NA 8.69E-83 mr1934_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322099539 4.96E-12 4.92E-162 mr1987_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251