\
| Variant ID: vg0322035566 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22035566 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTTGCTTAAAGTGCGGGGGCTACGATTCCTAGCTCTCTCCTAGCCCTGCGTCAAGCTCTGGGCGCCGTCGACGCCCGGGGCCCCCTGTGCTGGCTCTTCC[G/A]
TAGTGGTTGGCTCTAGCCCCGCCGGCTGGCTACAGTGCCTAGCTTGGCTTGATCGCGGGTGAAGATTGCTGGCTATGGAAAGTTCAGTCCTCACGCTCAC
GTGAGCGTGAGGACTGAACTTTCCATAGCCAGCAATCTTCACCCGCGATCAAGCCAAGCTAGGCACTGTAGCCAGCCGGCGGGGCTAGAGCCAACCACTA[C/T]
GGAAGAGCCAGCACAGGGGGCCCCGGGCGTCGACGGCGCCCAGAGCTTGACGCAGGGCTAGGAGAGAGCTAGGAATCGTAGCCCCCGCACTTTAAGCAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.70% | 34.00% | 0.11% | 0.28% | NA |
| All Indica | 2759 | 96.50% | 3.20% | 0.00% | 0.29% | NA |
| All Japonica | 1512 | 2.10% | 97.60% | 0.13% | 0.13% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.50% | 0.00% | 0.34% | NA |
| Indica II | 465 | 96.80% | 3.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 98.70% | 1.10% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 94.10% | 5.50% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 0.30% | 99.50% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 5.00% | 94.80% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 42.20% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322035566 | G -> A | LOC_Os03g39640-LOC_Os03g39650 | intergenic_region ; MODIFIER | silent_mutation | Average:68.843; most accessible tissue: Zhenshan97 flag leaf, score: 82.874 | N | N | N | N |
| vg0322035566 | G -> DEL | N | N | silent_mutation | Average:68.843; most accessible tissue: Zhenshan97 flag leaf, score: 82.874 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322035566 | NA | 8.22E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322035566 | NA | 7.53E-21 | mr1689 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322035566 | 2.24E-14 | 8.65E-86 | mr1718 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322035566 | 2.15E-13 | 8.44E-18 | mr1718 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322035566 | 1.73E-13 | 3.66E-123 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322035566 | 7.36E-16 | 1.11E-24 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322035566 | NA | 4.71E-35 | mr1828 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322035566 | 9.31E-07 | 9.31E-07 | mr1987 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322035566 | 2.88E-07 | NA | mr1718_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322035566 | NA | 2.46E-12 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322035566 | 1.03E-08 | NA | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322035566 | 5.66E-08 | 1.46E-26 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322035566 | NA | 1.83E-65 | mr1828_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322035566 | NA | 8.27E-08 | mr1987_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |