\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321985645:

Variant ID: vg0321985645 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21985645
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.52, T: 0.48, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGAACATTTCAGTAATTACCCACATATTAAATTAATAATTAAATGGTCTGATTATAACCTTGTTAAGTACTTTGAGTGTCCAAGTATTTTCAGGATTT[C/T]
TCTTGAAATTATTTGAGCATTGGAAGTATTTTTAACAATTCAAAGGTCATTTTAGTGATTAATTTAATTGGAAAAGTAATTAAAATCCTTTCCTTAGCTT

Reverse complement sequence

AAGCTAAGGAAAGGATTTTAATTACTTTTCCAATTAAATTAATCACTAAAATGACCTTTGAATTGTTAAAAATACTTCCAATGCTCAAATAATTTCAAGA[G/A]
AAATCCTGAAAATACTTGGACACTCAAAGTACTTAACAAGGTTATAATCAGACCATTTAATTATTAATTTAATATGTGGGTAATTACTGAAATGTTCTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.00% 39.10% 0.21% 17.63% NA
All Indica  2759 60.60% 9.10% 0.33% 29.90% NA
All Japonica  1512 8.90% 91.00% 0.00% 0.07% NA
Aus  269 71.40% 28.60% 0.00% 0.00% NA
Indica I  595 22.50% 8.60% 0.34% 68.57% NA
Indica II  465 84.10% 4.90% 0.43% 10.54% NA
Indica III  913 65.80% 8.30% 0.55% 25.30% NA
Indica Intermediate  786 69.60% 13.00% 0.00% 17.43% NA
Temperate Japonica  767 0.70% 99.20% 0.00% 0.13% NA
Tropical Japonica  504 9.70% 90.30% 0.00% 0.00% NA
Japonica Intermediate  241 33.60% 66.40% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 32.20% 58.90% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321985645 C -> T LOC_Os03g39590.1 upstream_gene_variant ; 2035.0bp to feature; MODIFIER silent_mutation Average:73.824; most accessible tissue: Zhenshan97 young leaf, score: 97.916 N N N N
vg0321985645 C -> T LOC_Os03g39594.1 downstream_gene_variant ; 3323.0bp to feature; MODIFIER silent_mutation Average:73.824; most accessible tissue: Zhenshan97 young leaf, score: 97.916 N N N N
vg0321985645 C -> T LOC_Os03g39598.1 downstream_gene_variant ; 4945.0bp to feature; MODIFIER silent_mutation Average:73.824; most accessible tissue: Zhenshan97 young leaf, score: 97.916 N N N N
vg0321985645 C -> T LOC_Os03g39590-LOC_Os03g39594 intergenic_region ; MODIFIER silent_mutation Average:73.824; most accessible tissue: Zhenshan97 young leaf, score: 97.916 N N N N
vg0321985645 C -> DEL N N silent_mutation Average:73.824; most accessible tissue: Zhenshan97 young leaf, score: 97.916 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0321985645 C T -0.01 -0.01 -0.01 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321985645 NA 4.03E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321985645 4.85E-06 NA mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321985645 5.18E-06 5.18E-06 mr1452 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321985645 NA 8.09E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321985645 NA 6.78E-06 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321985645 3.73E-06 NA mr1732 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321985645 NA 7.70E-06 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251