\
| Variant ID: vg0321960786 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21960786 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, T: 0.02, G: 0.01, others allele: 0.00, population size: 113. )
TCCACTTTATGAATGGTGGCAGGAAATAACAAGATGATAAAAAAATCAATATACAAATATACTCTCTTTATTCTCAAATAGATTGTGTTTAGAATAATGT[A/T]
GTGCCACTGCTGGAGAAACCATCTTTGTTGGGTTCGCCAAAAACAACATTATTCCTGGTTCCAATAAGAACCGGGACTAAACATTATTTTTTTGTCCCGG
CCGGGACAAAAAAATAATGTTTAGTCCCGGTTCTTATTGGAACCAGGAATAATGTTGTTTTTGGCGAACCCAACAAAGATGGTTTCTCCAGCAGTGGCAC[T/A]
ACATTATTCTAAACACAATCTATTTGAGAATAAAGAGAGTATATTTGTATATTGATTTTTTTATCATCTTGTTATTTCCTGCCACCATTCATAAAGTGGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.90% | 45.00% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 90.30% | 9.60% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 20.10% | 79.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.10% | 8.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 84.90% | 14.90% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 60.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321960786 | A -> T | LOC_Os03g39540.1 | upstream_gene_variant ; 296.0bp to feature; MODIFIER | silent_mutation | Average:40.088; most accessible tissue: Minghui63 flag leaf, score: 60.569 | N | N | N | N |
| vg0321960786 | A -> T | LOC_Os03g39530.1 | downstream_gene_variant ; 4329.0bp to feature; MODIFIER | silent_mutation | Average:40.088; most accessible tissue: Minghui63 flag leaf, score: 60.569 | N | N | N | N |
| vg0321960786 | A -> T | LOC_Os03g39550.1 | downstream_gene_variant ; 2429.0bp to feature; MODIFIER | silent_mutation | Average:40.088; most accessible tissue: Minghui63 flag leaf, score: 60.569 | N | N | N | N |
| vg0321960786 | A -> T | LOC_Os03g39540-LOC_Os03g39550 | intergenic_region ; MODIFIER | silent_mutation | Average:40.088; most accessible tissue: Minghui63 flag leaf, score: 60.569 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321960786 | NA | 8.71E-06 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321960786 | NA | 2.00E-13 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321960786 | 2.33E-06 | NA | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321960786 | 1.34E-11 | 6.46E-25 | mr1750_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |