\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321897970:

Variant ID: vg0321897970 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21897970
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTTATCACTCGACGCGCTGTCAAGCGGAAGAAGACGCTGAGAAGTCGAAGGAACTCTCGCGAAGTAGCGCGCGTCGATGTAGAGGAAATAGTCGATCG[C/T]
ACCGGCTCGACCTTCTCCTCCTCGTGCGTTCTGCTCGCCGTACTCCCACGCCGATCAGCACTGCAAACCAGCGGCACCTCTACCGGTATCCACACGTACA

Reverse complement sequence

TGTACGTGTGGATACCGGTAGAGGTGCCGCTGGTTTGCAGTGCTGATCGGCGTGGGAGTACGGCGAGCAGAACGCACGAGGAGGAGAAGGTCGAGCCGGT[G/A]
CGATCGACTATTTCCTCTACATCGACGCGCGCTACTTCGCGAGAGTTCCTTCGACTTCTCAGCGTCTTCTTCCGCTTGACAGCGCGTCGAGTGATAACGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 18.20% 0.04% 0.00% NA
All Indica  2759 69.20% 30.80% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 29.70% 70.30% 0.00% 0.00% NA
Indica II  465 89.50% 10.50% 0.00% 0.00% NA
Indica III  913 73.40% 26.60% 0.00% 0.00% NA
Indica Intermediate  786 82.20% 17.70% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321897970 C -> T LOC_Os03g39407.1 upstream_gene_variant ; 2444.0bp to feature; MODIFIER silent_mutation Average:38.569; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0321897970 C -> T LOC_Os03g39400.1 intron_variant ; MODIFIER silent_mutation Average:38.569; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321897970 NA 1.03E-08 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321897970 NA 1.06E-06 mr1081 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321897970 NA 6.44E-07 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321897970 NA 6.48E-07 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321897970 NA 1.79E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321897970 NA 8.03E-11 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321897970 NA 4.14E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321897970 NA 4.70E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321897970 NA 2.58E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321897970 NA 3.17E-06 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321897970 NA 5.49E-06 mr1749 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321897970 NA 5.74E-06 mr1804 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321897970 4.10E-06 8.15E-07 mr1816 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321897970 NA 1.37E-06 mr1857 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321897970 NA 2.33E-07 mr1857 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321897970 NA 5.85E-06 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321897970 NA 1.39E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321897970 NA 2.58E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251