\
| Variant ID: vg0321873075 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21873075 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 100. )
GGGTGCAATTACTCAAGGAAGTTGAAGCCGATACCATTGAAATCATGGGGGATTCTTTGCTAGTAATCAGTCAATTGGCAGAAGAGTATGAATGCAAGAA[C/T]
GATACATTGATGGTTTATAATGAGAAGTGCCAGGAACTAATGAAAGAGTTTCGGCTGGTTACATTAAAGCATGTCTCTTAAGAACAAAATATTAAAGCTA
TAGCTTTAATATTTTGTTCTTAAGAGACATGCTTTAATGTAACCAGCCGAAACTCTTTCATTAGTTCCTGGCACTTCTCATTATAAACCATCAATGTATC[G/A]
TTCTTGCATTCATACTCTTCTGCCAATTGACTGATTACTAGCAAAGAATCCCCCATGATTTCAATGGTATCGGCTTCAACTTCCTTGAGTAATTGCACCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.00% | 21.10% | 5.27% | 31.68% | NA |
| All Indica | 2759 | 15.20% | 32.00% | 5.84% | 46.94% | NA |
| All Japonica | 1512 | 98.10% | 0.30% | 0.00% | 1.65% | NA |
| Aus | 269 | 9.30% | 0.70% | 31.60% | 58.36% | NA |
| Indica I | 595 | 19.80% | 67.40% | 4.54% | 8.24% | NA |
| Indica II | 465 | 23.40% | 12.70% | 6.67% | 57.20% | NA |
| Indica III | 913 | 2.70% | 28.60% | 3.50% | 65.17% | NA |
| Indica Intermediate | 786 | 21.40% | 20.60% | 9.03% | 48.98% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 0.00% | 0.00% | 4.76% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 4.20% | 92.70% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 57.80% | 20.00% | 2.22% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321873075 | C -> T | LOC_Os03g39350.1 | synonymous_variant ; p.Asn1232Asn; LOW | synonymous_codon | Average:33.612; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 | N | N | N | N |
| vg0321873075 | C -> DEL | LOC_Os03g39350.1 | N | frameshift_variant | Average:33.612; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321873075 | NA | 5.14E-09 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321873075 | NA | 2.76E-23 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321873075 | NA | 1.18E-17 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321873075 | NA | 2.74E-12 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321873075 | NA | 7.08E-16 | mr1636 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321873075 | NA | 7.63E-14 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321873075 | NA | 9.30E-09 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321873075 | NA | 2.87E-15 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321873075 | 6.52E-06 | NA | mr1987 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321873075 | 3.75E-08 | NA | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321873075 | NA | 8.57E-15 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321873075 | 5.09E-06 | NA | mr1987_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |