| Variant ID: vg0321862328 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21862328 |
| Reference Allele: T | Alternative Allele: C,A |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 108. )
GCTAGGTAAGCAGACGTAGCCGATCCCGACAATACAACTTAATGTGTGATGTCGGGTTCGATTGAGGTGCTTCAAGGTGGTTGCCGTACATGGATAGAGT[T/C,A]
CTGAGGAGGCAATTGTATCTATTAATTAGGATGTTTTATATAATTTCCTTAGAGATACGTTTGGGCAAAAGTCTGCCGCAAAGACTTATGGTATCTTAGA
TCTAAGATACCATAAGTCTTTGCGGCAGACTTTTGCCCAAACGTATCTCTAAGGAAATTATATAAAACATCCTAATTAATAGATACAATTGCCTCCTCAG[A/G,T]
ACTCTATCCATGTACGGCAACCACCTTGAAGCACCTCAATCGAACCCGACATCACACATTAAGTTGTATTGTCGGGATCGGCTACGTCTGCTTACCTAGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.60% | 26.20% | 11.13% | 23.40% | A: 0.68% |
| All Indica | 2759 | 13.90% | 36.20% | 18.41% | 30.34% | A: 1.16% |
| All Japonica | 1512 | 89.80% | 8.50% | 0.33% | 1.32% | NA |
| Aus | 269 | 9.70% | 1.10% | 2.60% | 86.62% | NA |
| Indica I | 595 | 18.00% | 69.90% | 5.71% | 6.39% | NA |
| Indica II | 465 | 21.30% | 14.60% | 12.04% | 52.04% | NA |
| Indica III | 913 | 2.10% | 34.30% | 30.23% | 31.43% | A: 1.97% |
| Indica Intermediate | 786 | 20.20% | 25.60% | 18.07% | 34.35% | A: 1.78% |
| Temperate Japonica | 767 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.10% | 5.20% | 0.99% | 3.77% | NA |
| Japonica Intermediate | 241 | 63.50% | 36.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 4.20% | 92.70% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 55.60% | 23.30% | 5.56% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321862328 | T -> C | LOC_Os03g39350.1 | upstream_gene_variant ; 4354.0bp to feature; MODIFIER | silent_mutation | Average:36.459; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| vg0321862328 | T -> C | LOC_Os03g39330-LOC_Os03g39350 | intergenic_region ; MODIFIER | silent_mutation | Average:36.459; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| vg0321862328 | T -> A | LOC_Os03g39350.1 | upstream_gene_variant ; 4354.0bp to feature; MODIFIER | silent_mutation | Average:36.459; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| vg0321862328 | T -> A | LOC_Os03g39330-LOC_Os03g39350 | intergenic_region ; MODIFIER | silent_mutation | Average:36.459; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| vg0321862328 | T -> DEL | N | N | silent_mutation | Average:36.459; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321862328 | 4.42E-06 | 3.97E-07 | mr1415 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321862328 | 4.42E-06 | 3.97E-07 | mr1567 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |