Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0321862328:

Variant ID: vg0321862328 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 21862328
Reference Allele: T	Alternative Allele: C,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

GCTAGGTAAGCAGACGTAGCCGATCCCGACAATACAACTTAATGTGTGATGTCGGGTTCGATTGAGGTGCTTCAAGGTGGTTGCCGTACATGGATAGAGT[T/C,A]
CTGAGGAGGCAATTGTATCTATTAATTAGGATGTTTTATATAATTTCCTTAGAGATACGTTTGGGCAAAAGTCTGCCGCAAAGACTTATGGTATCTTAGA

Reverse complement sequence

TCTAAGATACCATAAGTCTTTGCGGCAGACTTTTGCCCAAACGTATCTCTAAGGAAATTATATAAAACATCCTAATTAATAGATACAATTGCCTCCTCAG[A/G,T]
ACTCTATCCATGTACGGCAACCACCTTGAAGCACCTCAATCGAACCCGACATCACACATTAAGTTGTATTGTCGGGATCGGCTACGTCTGCTTACCTAGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.60%	26.20%	11.13%	23.40%	A: 0.68%
All Indica	2759	13.90%	36.20%	18.41%	30.34%	A: 1.16%
All Japonica	1512	89.80%	8.50%	0.33%	1.32%	NA
Aus	269	9.70%	1.10%	2.60%	86.62%	NA
Indica I	595	18.00%	69.90%	5.71%	6.39%	NA
Indica II	465	21.30%	14.60%	12.04%	52.04%	NA
Indica III	913	2.10%	34.30%	30.23%	31.43%	A: 1.97%
Indica Intermediate	786	20.20%	25.60%	18.07%	34.35%	A: 1.78%
Temperate Japonica	767	97.90%	2.10%	0.00%	0.00%	NA
Tropical Japonica	504	90.10%	5.20%	0.99%	3.77%	NA
Japonica Intermediate	241	63.50%	36.10%	0.00%	0.41%	NA
VI/Aromatic	96	4.20%	92.70%	1.04%	2.08%	NA
Intermediate	90	55.60%	23.30%	5.56%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0321862328	T -> C	LOC_Os03g39350.1	upstream_gene_variant ; 4354.0bp to feature; MODIFIER	silent_mutation	Average:36.459; most accessible tissue: Minghui63 flag leaf, score: 57.188	N	N	N	N
vg0321862328	T -> C	LOC_Os03g39330-LOC_Os03g39350	intergenic_region ; MODIFIER	silent_mutation	Average:36.459; most accessible tissue: Minghui63 flag leaf, score: 57.188	N	N	N	N
vg0321862328	T -> A	LOC_Os03g39350.1	upstream_gene_variant ; 4354.0bp to feature; MODIFIER	silent_mutation	Average:36.459; most accessible tissue: Minghui63 flag leaf, score: 57.188	N	N	N	N
vg0321862328	T -> A	LOC_Os03g39330-LOC_Os03g39350	intergenic_region ; MODIFIER	silent_mutation	Average:36.459; most accessible tissue: Minghui63 flag leaf, score: 57.188	N	N	N	N
vg0321862328	T -> DEL	N	N	silent_mutation	Average:36.459; most accessible tissue: Minghui63 flag leaf, score: 57.188	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0321862328	4.42E-06	3.97E-07	mr1415	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321862328	4.42E-06	3.97E-07	mr1567	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251