\
| Variant ID: vg0321809303 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21809303 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 85. )
TCCTCTTCACGGATCCTCAACTGGTGATAGCCTGATCGCAGGTCCATCTTAGGGAACACTGTAGCTCCTTTCAACTGATCAAACAGATCATCAATCCTTG[A/G]
CAAAGGGTACTTGTTCTTAATAGTGACCTCATTGAGTGCGTACTAGTTAACGCACATCCTCTTGGTTTTGTCTTTCTTTTCCACAAAGATTACCGGAGCA
TGCTCCGGTAATCTTTGTGGAAAAGAAAGACAAAACCAAGAGGATGTGCGTTAACTAGTACGCACTCAATGAGGTCACTATTAAGAACAAGTACCCTTTG[T/C]
CAAGGATTGATGATCTGTTTGATCAGTTGAAAGGAGCTACAGTGTTCCCTAAGATGGACCTGCGATCAGGCTATCACCAGTTGAGGATCCGTGAAGAGGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.20% | 24.50% | 0.76% | 42.59% | NA |
| All Indica | 2759 | 4.30% | 33.20% | 1.16% | 61.29% | NA |
| All Japonica | 1512 | 89.70% | 8.50% | 0.00% | 1.79% | NA |
| Aus | 269 | 0.70% | 0.40% | 1.49% | 97.40% | NA |
| Indica I | 595 | 4.90% | 72.60% | 0.34% | 22.18% | NA |
| Indica II | 465 | 4.50% | 12.70% | 1.08% | 81.72% | NA |
| Indica III | 913 | 1.20% | 28.60% | 1.10% | 69.11% | NA |
| Indica Intermediate | 786 | 7.40% | 21.00% | 1.91% | 69.72% | NA |
| Temperate Japonica | 767 | 97.90% | 2.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 89.90% | 5.20% | 0.00% | 4.96% | NA |
| Japonica Intermediate | 241 | 63.50% | 36.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 2.10% | 92.70% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 45.60% | 23.30% | 0.00% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321809303 | A -> DEL | LOC_Os03g39250.1 | N | frameshift_variant | Average:46.128; most accessible tissue: Minghui63 flag leaf, score: 73.334 | N | N | N | N |
| vg0321809303 | A -> G | LOC_Os03g39250.1 | missense_variant ; p.Ser606Pro; MODERATE | nonsynonymous_codon ; S606P | Average:46.128; most accessible tissue: Minghui63 flag leaf, score: 73.334 | benign |
-0.593 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321809303 | NA | 6.53E-08 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809303 | NA | 8.15E-07 | mr1081 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809303 | 8.01E-06 | NA | mr1130 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809303 | NA | 1.37E-10 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809303 | NA | 9.83E-10 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809303 | NA | 2.03E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809303 | NA | 2.31E-07 | mr1254 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809303 | NA | 5.47E-06 | mr1256 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809303 | NA | 7.42E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809303 | NA | 3.64E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809303 | NA | 6.48E-07 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809303 | NA | 4.64E-06 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809303 | 9.06E-07 | 9.05E-07 | mr1681 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809303 | NA | 9.04E-07 | mr1857 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |