\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321809218:

Variant ID: vg0321809218 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21809218
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAGGCAGGTTCGTTGGTGAGTCCGAAAGACATAACTGTACATTCGAACAACCCATAACAAGTGATGAATGCAGTCTTTGGAATATCCTCTTCACGGATC[C/T]
TCAACTGGTGATAGCCTGATCGCAGGTCCATCTTAGGGAACACTGTAGCTCCTTTCAACTGATCAAACAGATCATCAATCCTTGACAAAGGGTACTTGTT

Reverse complement sequence

AACAAGTACCCTTTGTCAAGGATTGATGATCTGTTTGATCAGTTGAAAGGAGCTACAGTGTTCCCTAAGATGGACCTGCGATCAGGCTATCACCAGTTGA[G/A]
GATCCGTGAAGAGGATATTCCAAAGACTGCATTCATCACTTGTTATGGGTTGTTCGAATGTACAGTTATGTCTTTCGGACTCACCAACGAACCTGCCTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.90% 19.30% 0.95% 41.79% NA
All Indica  2759 5.70% 32.80% 1.23% 60.31% NA
All Japonica  1512 98.10% 0.10% 0.07% 1.72% NA
Aus  269 2.60% 0.00% 3.72% 93.68% NA
Indica I  595 5.20% 72.30% 0.34% 22.18% NA
Indica II  465 5.40% 12.70% 1.72% 80.22% NA
Indica III  913 2.40% 28.40% 0.99% 68.24% NA
Indica Intermediate  786 10.10% 19.80% 1.91% 68.19% NA
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 95.00% 0.00% 0.20% 4.76% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 60.00% 8.90% 0.00% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321809218 C -> T LOC_Os03g39250.1 missense_variant ; p.Arg634Lys; MODERATE nonsynonymous_codon ; R634K Average:46.385; most accessible tissue: Minghui63 flag leaf, score: 64.284 benign 0.64 DELETERIOUS 0.01
vg0321809218 C -> DEL LOC_Os03g39250.1 N frameshift_variant Average:46.385; most accessible tissue: Minghui63 flag leaf, score: 64.284 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321809218 NA 1.96E-08 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321809218 NA 3.51E-08 mr1081 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321809218 NA 4.94E-10 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321809218 NA 6.84E-11 mr1148 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321809218 NA 9.41E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321809218 NA 6.81E-07 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321809218 NA 3.56E-11 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321809218 NA 4.72E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321809218 NA 1.97E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321809218 NA 5.31E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321809218 NA 6.33E-08 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321809218 NA 9.97E-06 mr1680 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321809218 5.34E-06 7.74E-08 mr1857 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321809218 5.77E-06 2.08E-09 mr1857 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321809218 NA 3.18E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321809218 NA 3.98E-06 mr1928 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321809218 NA 6.15E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321809218 NA 2.56E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321809218 NA 5.29E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251