\
| Variant ID: vg0321809157 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21809157 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 94. )
TGAAAACCACGACAAACTTGTCTAGAAATTCCATAAACACCTTGTTCATCAAATTCATGAAGAAGGCAGGTTCGTTGGTGAGTCCGAAAGACATAACTGT[A/G]
CATTCGAACAACCCATAACAAGTGATGAATGCAGTCTTTGGAATATCCTCTTCACGGATCCTCAACTGGTGATAGCCTGATCGCAGGTCCATCTTAGGGA
TCCCTAAGATGGACCTGCGATCAGGCTATCACCAGTTGAGGATCCGTGAAGAGGATATTCCAAAGACTGCATTCATCACTTGTTATGGGTTGTTCGAATG[T/C]
ACAGTTATGTCTTTCGGACTCACCAACGAACCTGCCTTCTTCATGAATTTGATGAACAAGGTGTTTATGGAATTTCTAGACAAGTTTGTCGTGGTTTTCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.30% | 24.30% | 0.74% | 42.64% | NA |
| All Indica | 2759 | 4.50% | 32.90% | 1.23% | 61.33% | NA |
| All Japonica | 1512 | 89.80% | 8.40% | 0.00% | 1.79% | NA |
| Aus | 269 | 1.10% | 0.70% | 0.37% | 97.77% | NA |
| Indica I | 595 | 4.90% | 72.10% | 0.34% | 22.69% | NA |
| Indica II | 465 | 5.40% | 12.70% | 1.08% | 80.86% | NA |
| Indica III | 913 | 1.20% | 28.40% | 1.42% | 69.00% | NA |
| Indica Intermediate | 786 | 7.50% | 20.60% | 1.78% | 70.10% | NA |
| Temperate Japonica | 767 | 97.90% | 2.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 89.90% | 5.20% | 0.00% | 4.96% | NA |
| Japonica Intermediate | 241 | 63.90% | 35.70% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 2.10% | 92.70% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 44.40% | 24.40% | 0.00% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321809157 | A -> DEL | LOC_Os03g39250.1 | N | frameshift_variant | Average:42.553; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0321809157 | A -> G | LOC_Os03g39250.1 | synonymous_variant ; p.Cys654Cys; LOW | synonymous_codon | Average:42.553; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321809157 | NA | 8.22E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809157 | NA | 4.35E-06 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809157 | NA | 3.44E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809157 | 2.14E-06 | NA | mr1229 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809157 | NA | 1.31E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809157 | NA | 9.90E-06 | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809157 | NA | 2.89E-06 | mr1413 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809157 | NA | 2.20E-07 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809157 | NA | 2.45E-07 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809157 | NA | 2.36E-07 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809157 | NA | 1.64E-07 | mr1680 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809157 | NA | 1.47E-06 | mr1734 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809157 | NA | 3.65E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321809157 | NA | 1.29E-06 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |