\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321780200:

Variant ID: vg0321780200 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21780200
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


CAGACCGGTGAACCGAAAGGTCTGCCGGGTCAAGCTCCGGTCCGAGTTTTTATTCTATGGCGCGGAGAGGGGGCGGCGGACGCGCCGCGCGGGAGACCGA[C/A]
TTTTCCCTTCTTTTATTTTTTTTTGCTTTTCCATGTTTTCTGTTTCTGTTCGGTTGCTGTTTTTTCCTTTTTTTTTTTGTTTCTGTTAAGATTGGTTTTC

Reverse complement sequence

GAAAACCAATCTTAACAGAAACAAAAAAAAAAAGGAAAAAACAGCAACCGAACAGAAACAGAAAACATGGAAAAGCAAAAAAAAATAAAAGAAGGGAAAA[G/T]
TCGGTCTCCCGCGCGGCGCGTCCGCCGCCCCCTCTCCGCGCCATAGAATAAAAACTCGGACCGGAGCTTGACCCGGCAGACCTTTCGGTTCACCGGTCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.70% 18.20% 0.13% 0.00% NA
All Indica  2759 68.90% 30.80% 0.22% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 29.90% 70.10% 0.00% 0.00% NA
Indica II  465 88.80% 11.00% 0.22% 0.00% NA
Indica III  913 73.40% 26.40% 0.22% 0.00% NA
Indica Intermediate  786 81.60% 18.10% 0.38% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321780200 C -> A LOC_Os03g39210.1 upstream_gene_variant ; 800.0bp to feature; MODIFIER silent_mutation Average:33.839; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N
vg0321780200 C -> A LOC_Os03g39224.1 upstream_gene_variant ; 4019.0bp to feature; MODIFIER silent_mutation Average:33.839; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N
vg0321780200 C -> A LOC_Os03g39220.1 downstream_gene_variant ; 1982.0bp to feature; MODIFIER silent_mutation Average:33.839; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N
vg0321780200 C -> A LOC_Os03g39230.1 downstream_gene_variant ; 4648.0bp to feature; MODIFIER silent_mutation Average:33.839; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N
vg0321780200 C -> A LOC_Os03g39210-LOC_Os03g39220 intergenic_region ; MODIFIER silent_mutation Average:33.839; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321780200 NA 1.06E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 5.66E-08 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 6.32E-07 mr1081 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 3.89E-10 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 1.80E-10 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 5.41E-08 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 8.13E-11 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 6.83E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 8.15E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 7.71E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 1.52E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 6.67E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 3.44E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 7.55E-07 1.21E-08 mr1857 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 1.22E-06 4.20E-10 mr1857 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 2.20E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 3.64E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 3.48E-06 mr1928 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 5.45E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 6.61E-06 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 2.29E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200 NA 3.24E-10 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251