Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321780200:

Variant ID: vg0321780200 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 21780200
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

CAGACCGGTGAACCGAAAGGTCTGCCGGGTCAAGCTCCGGTCCGAGTTTTTATTCTATGGCGCGGAGAGGGGGCGGCGGACGCGCCGCGCGGGAGACCGA[C/A]
TTTTCCCTTCTTTTATTTTTTTTTGCTTTTCCATGTTTTCTGTTTCTGTTCGGTTGCTGTTTTTTCCTTTTTTTTTTTGTTTCTGTTAAGATTGGTTTTC

Reverse complement sequence

GAAAACCAATCTTAACAGAAACAAAAAAAAAAAGGAAAAAACAGCAACCGAACAGAAACAGAAAACATGGAAAAGCAAAAAAAAATAAAAGAAGGGAAAA[G/T]
TCGGTCTCCCGCGCGGCGCGTCCGCCGCCCCCTCTCCGCGCCATAGAATAAAAACTCGGACCGGAGCTTGACCCGGCAGACCTTTCGGTTCACCGGTCTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.70%	18.20%	0.13%	0.00%	NA
All Indica	2759	68.90%	30.80%	0.22%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	29.90%	70.10%	0.00%	0.00%	NA
Indica II	465	88.80%	11.00%	0.22%	0.00%	NA
Indica III	913	73.40%	26.40%	0.22%	0.00%	NA
Indica Intermediate	786	81.60%	18.10%	0.38%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0321780200	C -> A	LOC_Os03g39210.1	upstream_gene_variant ; 800.0bp to feature; MODIFIER	silent_mutation	Average:33.839; most accessible tissue: Zhenshan97 flower, score: 46.765	N	N	N	N
vg0321780200	C -> A	LOC_Os03g39224.1	upstream_gene_variant ; 4019.0bp to feature; MODIFIER	silent_mutation	Average:33.839; most accessible tissue: Zhenshan97 flower, score: 46.765	N	N	N	N
vg0321780200	C -> A	LOC_Os03g39220.1	downstream_gene_variant ; 1982.0bp to feature; MODIFIER	silent_mutation	Average:33.839; most accessible tissue: Zhenshan97 flower, score: 46.765	N	N	N	N
vg0321780200	C -> A	LOC_Os03g39230.1	downstream_gene_variant ; 4648.0bp to feature; MODIFIER	silent_mutation	Average:33.839; most accessible tissue: Zhenshan97 flower, score: 46.765	N	N	N	N
vg0321780200	C -> A	LOC_Os03g39210-LOC_Os03g39220	intergenic_region ; MODIFIER	silent_mutation	Average:33.839; most accessible tissue: Zhenshan97 flower, score: 46.765	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0321780200	NA	1.06E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	5.66E-08	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	6.32E-07	mr1081	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	3.89E-10	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	1.80E-10	mr1148	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	5.41E-08	mr1254	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	8.13E-11	mr1272	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	6.83E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	8.15E-13	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	7.71E-06	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	1.52E-07	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	6.67E-07	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	3.44E-06	mr1734	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	7.55E-07	1.21E-08	mr1857	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	1.22E-06	4.20E-10	mr1857	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	2.20E-08	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	3.64E-06	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	3.48E-06	mr1928	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	5.45E-06	mr1942	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	6.61E-06	mr1125_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	2.29E-06	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321780200	NA	3.24E-10	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251