\
| Variant ID: vg0321774470 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21774470 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.59, C: 0.41, others allele: 0.00, population size: 107. )
CGGGATCTGCGAACACCCAACCCAACCGACGCCGTTGCCTCCGCCGCTCCGAGCCTCCGATCCATTGCTGCGAGAAGGCTATTGGGTGATCAGCGCACGT[T/C]
CCTCCCCGCACGACTGGACACGTGTCGCGCGCGGAGCATAGTGGAAAAAACCGGACCGGTCCGGCGGTTGAACCAAAAAACCGGAACCGACATGCATTCG
CGAATGCATGTCGGTTCCGGTTTTTTGGTTCAACCGCCGGACCGGTCCGGTTTTTTCCACTATGCTCCGCGCGCGACACGTGTCCAGTCGTGCGGGGAGG[A/G]
ACGTGCGCTGATCACCCAATAGCCTTCTCGCAGCAATGGATCGGAGGCTCGGAGCGGCGGAGGCAACGGCGTCGGTTGGGTTGGGTGTTCGCAGATCCCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.50% | 47.20% | 0.25% | 0.08% | NA |
| All Indica | 2759 | 34.40% | 65.00% | 0.43% | 0.14% | NA |
| All Japonica | 1512 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 75.00% | 24.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 14.00% | 84.70% | 1.08% | 0.22% | NA |
| Indica III | 913 | 27.60% | 71.60% | 0.44% | 0.33% | NA |
| Indica Intermediate | 786 | 23.80% | 76.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 46.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321774470 | T -> C | LOC_Os03g39210.1 | downstream_gene_variant ; 861.0bp to feature; MODIFIER | silent_mutation | Average:76.74; most accessible tissue: Callus, score: 92.484 | N | N | N | N |
| vg0321774470 | T -> C | LOC_Os03g39200-LOC_Os03g39210 | intergenic_region ; MODIFIER | silent_mutation | Average:76.74; most accessible tissue: Callus, score: 92.484 | N | N | N | N |
| vg0321774470 | T -> DEL | N | N | silent_mutation | Average:76.74; most accessible tissue: Callus, score: 92.484 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321774470 | NA | 8.93E-06 | mr1029 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321774470 | NA | 1.45E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321774470 | NA | 1.30E-06 | mr1081 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321774470 | NA | 2.87E-08 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321774470 | NA | 1.18E-07 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321774470 | NA | 2.51E-09 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321774470 | NA | 9.13E-09 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321774470 | NA | 2.17E-07 | mr1254 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321774470 | NA | 4.57E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321774470 | NA | 8.42E-09 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321774470 | NA | 1.46E-06 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321774470 | 7.44E-06 | NA | mr1857 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321774470 | NA | 4.50E-09 | mr1857 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321774470 | NA | 9.55E-06 | mr1868 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321774470 | NA | 1.54E-06 | mr1928 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321774470 | NA | 9.42E-18 | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |