Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321582759:

Variant ID: vg0321582759 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 21582759
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.06, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

AGGCGATTCCAGGGCGGTCCGACCGAGAGATCAACACCGGTCAGACCGACGGCATAGGCACGATCAGACCGGCAGATCAATCTTGGTCAGACTGATCTCC[A/G]
TCGAATTTGAGGGTAACTTTTATTTCCGCTAAAAGTTTTGGTTTTTGGTTATACCAACCATTCACCCCCCTCTGGTTGGCTTAGTTGTTGTGTTTCGATC

Reverse complement sequence

GATCGAAACACAACAACTAAGCCAACCAGAGGGGGGTGAATGGTTGGTATAACCAAAAACCAAAACTTTTAGCGGAAATAAAAGTTACCCTCAAATTCGA[T/C]
GGAGATCAGTCTGACCAAGATTGATCTGCCGGTCTGATCGTGCCTATGCCGTCGGTCTGACCGGTGTTGATCTCTCGGTCGGACCGCCCTGGAATCGCCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.40%	24.90%	0.21%	0.40%	NA
All Indica	2759	57.60%	41.80%	0.29%	0.36%	NA
All Japonica	1512	99.00%	0.40%	0.00%	0.60%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	72.80%	26.60%	0.17%	0.50%	NA
Indica II	465	27.30%	72.00%	0.22%	0.43%	NA
Indica III	913	56.70%	42.90%	0.22%	0.11%	NA
Indica Intermediate	786	65.00%	34.00%	0.51%	0.51%	NA
Temperate Japonica	767	98.60%	0.30%	0.00%	1.17%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	76.70%	21.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0321582759	A -> DEL	N	N	silent_mutation	Average:59.301; most accessible tissue: Minghui63 young leaf, score: 75.006	N	N	N	N
vg0321582759	A -> G	LOC_Os03g38860.1	upstream_gene_variant ; 3064.0bp to feature; MODIFIER	silent_mutation	Average:59.301; most accessible tissue: Minghui63 young leaf, score: 75.006	N	N	N	N
vg0321582759	A -> G	LOC_Os03g38850.1	downstream_gene_variant ; 2194.0bp to feature; MODIFIER	silent_mutation	Average:59.301; most accessible tissue: Minghui63 young leaf, score: 75.006	N	N	N	N
vg0321582759	A -> G	LOC_Os03g38850-LOC_Os03g38860	intergenic_region ; MODIFIER	silent_mutation	Average:59.301; most accessible tissue: Minghui63 young leaf, score: 75.006	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0321582759	8.43E-06	8.43E-06	mr1770_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321582759	1.13E-08	1.13E-08	mr1946_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321582759	1.13E-08	1.13E-08	mr1948_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251