\
| Variant ID: vg0321577849 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21577849 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TGGCATCGTAGACTTGGACATGTTGGTTTTGATCATCTCACTAGGTTAAGTGGTTTGGATCTTGCTCGTGGTTTGCCTAAACTTAAGAAAGATTTTGATT[C/T,A]
GGTTTGTTCACTGTGTCGTCATGCTAAGATGGTTGCTTCTTCACATGCTCCTATTGTTTTTTGTGATGACGGATGCACCGGGACAGCTATTACACATAGA
TCTATGTGTAATAGCTGTCCCGGTGCATCCGTCATCACAAAAAACAATAGGAGCATGTGAAGAAGCAACCATCTTAGCATGACGACACAGTGAACAAACC[G/A,T]
AATCAAAATCTTTCTTAAGTTTAGGCAAACCACGAGCAAGATCCAAACCACTTAACCTAGTGAGATGATCAAAACCAACATGTCCAAGTCTACGATGCCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.20% | 33.70% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 58.70% | 41.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 10.10% | 89.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 35.30% | 64.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 42.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321577849 | C -> T | LOC_Os03g38850.1 | N | nonsynonymous_codon ; S839L | Average:17.186; most accessible tissue: Callus, score: 28.887 | unknown | unknown | TOLERATED | 0.13 |
| vg0321577849 | C -> A | LOC_Os03g38850.1 | stop_gained&splice_region_variant ; p.Ser839*; HIGH | N | Average:17.186; most accessible tissue: Callus, score: 28.887 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321577849 | NA | 2.41E-21 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321577849 | 1.92E-06 | NA | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321577849 | NA | 7.53E-21 | mr1253_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321577849 | NA | 6.84E-20 | mr1255_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321577849 | 7.87E-06 | 7.87E-06 | mr1312_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321577849 | NA | 1.50E-25 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321577849 | 5.90E-06 | 5.90E-06 | mr1645_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321577849 | 4.02E-06 | 4.02E-06 | mr1647_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321577849 | 2.78E-06 | 2.78E-06 | mr1657_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321577849 | NA | 6.57E-11 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |