| Variant ID: vg0321548437 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21548437 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 254. )
CAGCTGATGCTGCCATGGACCTCGATTGGATTGATTTCACTCGAGAAAGAAGTTGGCATGTGAAAAAGGAGAGGGGGTGTTTACATCTATGGAAGTTTTG[A/G]
CATGTCATATCGGGTATTATATAGGTTGTTGTATAGGGCGTTTGGACACTAATAAAAAGTAATTACATAATCCATCAGTAAACCACTAGACGAATTTATA
TATAAATTCGTCTAGTGGTTTACTGATGGATTATGTAATTACTTTTTATTAGTGTCCAAACGCCCTATACAACAACCTATATAATACCCGATATGACATG[T/C]
CAAAACTTCCATAGATGTAAACACCCCCTCTCCTTTTTCACATGCCAACTTCTTTCTCGAGTGAAATCAATCCAATCGAGGTCCATGGCAGCATCAGCTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.10% | 30.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 9.30% | 90.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 9.90% | 90.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 34.90% | 65.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 38.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321548437 | A -> G | LOC_Os03g38800.1 | upstream_gene_variant ; 1647.0bp to feature; MODIFIER | silent_mutation | Average:68.071; most accessible tissue: Callus, score: 84.022 | N | N | N | N |
| vg0321548437 | A -> G | LOC_Os03g38810.1 | upstream_gene_variant ; 1824.0bp to feature; MODIFIER | silent_mutation | Average:68.071; most accessible tissue: Callus, score: 84.022 | N | N | N | N |
| vg0321548437 | A -> G | LOC_Os03g38790.1 | downstream_gene_variant ; 3856.0bp to feature; MODIFIER | silent_mutation | Average:68.071; most accessible tissue: Callus, score: 84.022 | N | N | N | N |
| vg0321548437 | A -> G | LOC_Os03g38804.1 | downstream_gene_variant ; 489.0bp to feature; MODIFIER | silent_mutation | Average:68.071; most accessible tissue: Callus, score: 84.022 | N | N | N | N |
| vg0321548437 | A -> G | LOC_Os03g38790.2 | downstream_gene_variant ; 3783.0bp to feature; MODIFIER | silent_mutation | Average:68.071; most accessible tissue: Callus, score: 84.022 | N | N | N | N |
| vg0321548437 | A -> G | LOC_Os03g38804-LOC_Os03g38810 | intergenic_region ; MODIFIER | silent_mutation | Average:68.071; most accessible tissue: Callus, score: 84.022 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321548437 | NA | 5.31E-17 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321548437 | NA | 1.39E-43 | mr1194 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321548437 | NA | 6.16E-35 | mr1350 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321548437 | NA | 8.79E-39 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321548437 | NA | 5.51E-18 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321548437 | 2.32E-06 | 3.64E-06 | mr1559 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321548437 | NA | 7.41E-12 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321548437 | NA | 2.48E-20 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321548437 | NA | 6.13E-12 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321548437 | NA | 2.66E-14 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/