\
| Variant ID: vg0321537632 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21537632 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 236. )
AATACTCCCCCTCCAGCAGCAAGGGGACTCTCTTAGCACCCAATTCAATTGCATACACCCCTTGCACCTCTCTCGCACCCACTTGAGCTTTGTGTTCATC[T/C]
ATCTAGTGTGTTAGAGGGTTAATTAGCCAAGAGTCAAGTGCATTGCTTCCATTTGTAGAGCTAGTGTGGCACTTGATTGATCATCTCCACGCCGGGTCAT
ATGACCCGGCGTGGAGATGATCAATCAAGTGCCACACTAGCTCTACAAATGGAAGCAATGCACTTGACTCTTGGCTAATTAACCCTCTAACACACTAGAT[A/G]
GATGAACACAAAGCTCAAGTGGGTGCGAGAGAGGTGCAAGGGGTGTATGCAATTGAATTGGGTGCTAAGAGAGTCCCCTTGCTGCTGGAGGGGGAGTATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.60% | 31.10% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 97.40% | 2.20% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 9.30% | 90.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.10% | 2.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.10% | 1.20% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 2.40% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 0.80% | 99.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 9.90% | 90.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 34.90% | 65.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 41.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321537632 | T -> C | LOC_Os03g38780.1 | upstream_gene_variant ; 2363.0bp to feature; MODIFIER | silent_mutation | Average:56.638; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg0321537632 | T -> C | LOC_Os03g38790.1 | upstream_gene_variant ; 4350.0bp to feature; MODIFIER | silent_mutation | Average:56.638; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg0321537632 | T -> C | LOC_Os03g38790.2 | upstream_gene_variant ; 4633.0bp to feature; MODIFIER | silent_mutation | Average:56.638; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg0321537632 | T -> C | LOC_Os03g38780-LOC_Os03g38790 | intergenic_region ; MODIFIER | silent_mutation | Average:56.638; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321537632 | NA | 4.79E-08 | mr1334 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321537632 | NA | 1.03E-06 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321537632 | 1.26E-11 | NA | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321537632 | 2.68E-10 | 1.83E-15 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321537632 | 4.11E-07 | NA | mr1987 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321537632 | 1.43E-06 | 1.43E-06 | mr1987 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |