\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321537632:

Variant ID: vg0321537632 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21537632
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AATACTCCCCCTCCAGCAGCAAGGGGACTCTCTTAGCACCCAATTCAATTGCATACACCCCTTGCACCTCTCTCGCACCCACTTGAGCTTTGTGTTCATC[T/C]
ATCTAGTGTGTTAGAGGGTTAATTAGCCAAGAGTCAAGTGCATTGCTTCCATTTGTAGAGCTAGTGTGGCACTTGATTGATCATCTCCACGCCGGGTCAT

Reverse complement sequence

ATGACCCGGCGTGGAGATGATCAATCAAGTGCCACACTAGCTCTACAAATGGAAGCAATGCACTTGACTCTTGGCTAATTAACCCTCTAACACACTAGAT[A/G]
GATGAACACAAAGCTCAAGTGGGTGCGAGAGAGGTGCAAGGGGTGTATGCAATTGAATTGGGTGCTAAGAGAGTCCCCTTGCTGCTGGAGGGGGAGTATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.60% 31.10% 0.28% 0.00% NA
All Indica  2759 97.40% 2.20% 0.43% 0.00% NA
All Japonica  1512 9.30% 90.70% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 97.10% 2.70% 0.17% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 98.10% 1.20% 0.66% 0.00% NA
Indica Intermediate  786 96.90% 2.40% 0.64% 0.00% NA
Temperate Japonica  767 0.80% 99.10% 0.13% 0.00% NA
Tropical Japonica  504 9.90% 90.10% 0.00% 0.00% NA
Japonica Intermediate  241 34.90% 65.10% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 58.90% 41.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321537632 T -> C LOC_Os03g38780.1 upstream_gene_variant ; 2363.0bp to feature; MODIFIER silent_mutation Average:56.638; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N
vg0321537632 T -> C LOC_Os03g38790.1 upstream_gene_variant ; 4350.0bp to feature; MODIFIER silent_mutation Average:56.638; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N
vg0321537632 T -> C LOC_Os03g38790.2 upstream_gene_variant ; 4633.0bp to feature; MODIFIER silent_mutation Average:56.638; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N
vg0321537632 T -> C LOC_Os03g38780-LOC_Os03g38790 intergenic_region ; MODIFIER silent_mutation Average:56.638; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321537632 NA 4.79E-08 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321537632 NA 1.03E-06 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321537632 1.26E-11 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321537632 2.68E-10 1.83E-15 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321537632 4.11E-07 NA mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321537632 1.43E-06 1.43E-06 mr1987 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251