Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321537632:

Variant ID: vg0321537632 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 21537632
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

AATACTCCCCCTCCAGCAGCAAGGGGACTCTCTTAGCACCCAATTCAATTGCATACACCCCTTGCACCTCTCTCGCACCCACTTGAGCTTTGTGTTCATC[T/C]
ATCTAGTGTGTTAGAGGGTTAATTAGCCAAGAGTCAAGTGCATTGCTTCCATTTGTAGAGCTAGTGTGGCACTTGATTGATCATCTCCACGCCGGGTCAT

Reverse complement sequence

ATGACCCGGCGTGGAGATGATCAATCAAGTGCCACACTAGCTCTACAAATGGAAGCAATGCACTTGACTCTTGGCTAATTAACCCTCTAACACACTAGAT[A/G]
GATGAACACAAAGCTCAAGTGGGTGCGAGAGAGGTGCAAGGGGTGTATGCAATTGAATTGGGTGCTAAGAGAGTCCCCTTGCTGCTGGAGGGGGAGTATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.60%	31.10%	0.28%	0.00%	NA
All Indica	2759	97.40%	2.20%	0.43%	0.00%	NA
All Japonica	1512	9.30%	90.70%	0.07%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	97.10%	2.70%	0.17%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	98.10%	1.20%	0.66%	0.00%	NA
Indica Intermediate	786	96.90%	2.40%	0.64%	0.00%	NA
Temperate Japonica	767	0.80%	99.10%	0.13%	0.00%	NA
Tropical Japonica	504	9.90%	90.10%	0.00%	0.00%	NA
Japonica Intermediate	241	34.90%	65.10%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	58.90%	41.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0321537632	T -> C	LOC_Os03g38780.1	upstream_gene_variant ; 2363.0bp to feature; MODIFIER	silent_mutation	Average:56.638; most accessible tissue: Zhenshan97 flower, score: 71.992	N	N	N	N
vg0321537632	T -> C	LOC_Os03g38790.1	upstream_gene_variant ; 4350.0bp to feature; MODIFIER	silent_mutation	Average:56.638; most accessible tissue: Zhenshan97 flower, score: 71.992	N	N	N	N
vg0321537632	T -> C	LOC_Os03g38790.2	upstream_gene_variant ; 4633.0bp to feature; MODIFIER	silent_mutation	Average:56.638; most accessible tissue: Zhenshan97 flower, score: 71.992	N	N	N	N
vg0321537632	T -> C	LOC_Os03g38780-LOC_Os03g38790	intergenic_region ; MODIFIER	silent_mutation	Average:56.638; most accessible tissue: Zhenshan97 flower, score: 71.992	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0321537632	NA	4.79E-08	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321537632	NA	1.03E-06	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321537632	1.26E-11	NA	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321537632	2.68E-10	1.83E-15	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321537632	4.11E-07	NA	mr1987	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321537632	1.43E-06	1.43E-06	mr1987	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251