\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321535444:

Variant ID: vg0321535444 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21535444
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGGGCCCGCCGGCATCTGCACGTCTTTGGTCGAGGCGCATGCAGTAAACAGAACGGCGAAAAGCTCGGCGGTAGGGGCGAACCCACAGGTCCGACACAT[T/C]
CAAGCGAAAACCGCCAGCTTCGGGAACGCCGACGGGCTAAGCTGGGGAAGCCTAACCTCATATGTCGAAAGCACCGAAGGCAAGAAGTCATCGCACGGGA

Reverse complement sequence

TCCCGTGCGATGACTTCTTGCCTTCGGTGCTTTCGACATATGAGGTTAGGCTTCCCCAGCTTAGCCCGTCGGCGTTCCCGAAGCTGGCGGTTTTCGCTTG[A/G]
ATGTGTCGGACCTGTGGGTTCGCCCCTACCGCCGAGCTTTTCGCCGTTCTGTTTACTGCATGCGCCTCGACCAAAGACGTGCAGATGCCGGCGGGCCCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 30.90% 0.02% 0.00% NA
All Indica  2759 98.10% 1.90% 0.00% 0.00% NA
All Japonica  1512 9.40% 90.50% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.50% 2.50% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 2.20% 0.00% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 9.90% 89.90% 0.20% 0.00% NA
Japonica Intermediate  241 35.30% 64.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321535444 T -> C LOC_Os03g38780.1 upstream_gene_variant ; 175.0bp to feature; MODIFIER silent_mutation Average:66.989; most accessible tissue: Minghui63 flag leaf, score: 85.327 N N N N
vg0321535444 T -> C LOC_Os03g38764.1 downstream_gene_variant ; 4036.0bp to feature; MODIFIER silent_mutation Average:66.989; most accessible tissue: Minghui63 flag leaf, score: 85.327 N N N N
vg0321535444 T -> C LOC_Os03g38780-LOC_Os03g38790 intergenic_region ; MODIFIER silent_mutation Average:66.989; most accessible tissue: Minghui63 flag leaf, score: 85.327 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321535444 NA 3.47E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 3.82E-06 3.82E-06 mr1066 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 1.21E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 2.15E-35 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 4.58E-18 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 1.64E-22 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 5.71E-44 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 4.14E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 3.85E-26 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 1.09E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 2.77E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 2.28E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 9.27E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 1.94E-35 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 1.97E-39 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 6.84E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 8.32E-20 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 4.82E-07 4.82E-07 mr1571 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 3.18E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 8.03E-21 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 8.66E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 5.22E-15 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 2.25E-50 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 5.93E-06 2.97E-67 mr1711 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 7.62E-06 7.62E-06 mr1711 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 4.30E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 2.22E-09 2.03E-124 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 5.16E-21 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 4.01E-22 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 4.66E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 5.76E-40 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 8.03E-06 8.03E-06 mr1904 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 1.68E-13 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 9.22E-25 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 1.18E-34 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 8.53E-06 3.71E-38 mr1944 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 7.99E-07 2.38E-07 mr1944 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 8.00E-06 7.62E-99 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 3.42E-31 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 6.52E-30 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 1.17E-08 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 6.47E-06 6.46E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 3.76E-06 3.76E-06 mr1329_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 6.93E-26 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 2.18E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 NA 6.74E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 7.31E-06 7.31E-06 mr1663_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 5.16E-06 5.16E-06 mr1669_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321535444 1.52E-08 5.92E-153 mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251