\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321495504:

Variant ID: vg0321495504 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21495504
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.03, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CTTAGTTATGCTACTTTCTCCATTTTAAAATATAAAAATCTAGTACCGAATGATATATTTTCTATTACTATGAATATGTATCTATAGAAAATGTTTTATT[T/C]
AAATTTAGGTTATTATATTTTAAGACGTAGGTGACATCTAAATACCGTTAGTATGGATTTATTGCTTGAAGTTGCCAACGTGTGGTACGTGTGTGCCATA

Reverse complement sequence

TATGGCACACACGTACCACACGTTGGCAACTTCAAGCAATAAATCCATACTAACGGTATTTAGATGTCACCTACGTCTTAAAATATAATAACCTAAATTT[A/G]
AATAAAACATTTTCTATAGATACATATTCATAGTAATAGAAAATATATCATTCGGTACTAGATTTTTATATTTTAAAATGGAGAAAGTAGCATAACTAAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.70% 0.70% 9.23% 50.34% NA
All Indica  2759 5.00% 1.10% 10.80% 83.11% NA
All Japonica  1512 98.30% 0.00% 1.06% 0.60% NA
Aus  269 39.40% 1.50% 43.49% 15.61% NA
Indica I  595 4.40% 1.00% 20.17% 74.45% NA
Indica II  465 3.40% 2.20% 10.54% 83.87% NA
Indica III  913 4.20% 0.90% 4.60% 90.36% NA
Indica Intermediate  786 7.30% 0.90% 11.07% 80.79% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 95.40% 0.00% 3.17% 1.39% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 60.00% 0.00% 5.56% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321495504 T -> C LOC_Os03g38730.1 upstream_gene_variant ; 2553.0bp to feature; MODIFIER silent_mutation Average:24.307; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 N N N N
vg0321495504 T -> C LOC_Os03g38730.2 upstream_gene_variant ; 2553.0bp to feature; MODIFIER silent_mutation Average:24.307; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 N N N N
vg0321495504 T -> C LOC_Os03g38730.3 upstream_gene_variant ; 2553.0bp to feature; MODIFIER silent_mutation Average:24.307; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 N N N N
vg0321495504 T -> C LOC_Os03g38720.1 downstream_gene_variant ; 323.0bp to feature; MODIFIER silent_mutation Average:24.307; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 N N N N
vg0321495504 T -> C LOC_Os03g38720-LOC_Os03g38730 intergenic_region ; MODIFIER silent_mutation Average:24.307; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 N N N N
vg0321495504 T -> DEL N N silent_mutation Average:24.307; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321495504 NA 6.07E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504 NA 4.51E-07 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504 1.88E-08 1.80E-91 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504 2.11E-06 2.69E-11 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504 NA 5.65E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504 1.77E-16 3.68E-137 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504 1.56E-16 2.51E-31 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504 1.35E-08 1.35E-08 mr1987 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504 NA 7.54E-37 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504 NA 8.03E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504 1.10E-17 3.31E-137 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504 9.33E-14 1.16E-23 mr1718_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504 8.59E-18 7.89E-175 mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504 4.55E-16 4.94E-45 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504 NA 9.23E-09 mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251