\
| Variant ID: vg0321495504 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21495504 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.03, others allele: 0.00, population size: 103. )
CTTAGTTATGCTACTTTCTCCATTTTAAAATATAAAAATCTAGTACCGAATGATATATTTTCTATTACTATGAATATGTATCTATAGAAAATGTTTTATT[T/C]
AAATTTAGGTTATTATATTTTAAGACGTAGGTGACATCTAAATACCGTTAGTATGGATTTATTGCTTGAAGTTGCCAACGTGTGGTACGTGTGTGCCATA
TATGGCACACACGTACCACACGTTGGCAACTTCAAGCAATAAATCCATACTAACGGTATTTAGATGTCACCTACGTCTTAAAATATAATAACCTAAATTT[A/G]
AATAAAACATTTTCTATAGATACATATTCATAGTAATAGAAAATATATCATTCGGTACTAGATTTTTATATTTTAAAATGGAGAAAGTAGCATAACTAAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.70% | 0.70% | 9.23% | 50.34% | NA |
| All Indica | 2759 | 5.00% | 1.10% | 10.80% | 83.11% | NA |
| All Japonica | 1512 | 98.30% | 0.00% | 1.06% | 0.60% | NA |
| Aus | 269 | 39.40% | 1.50% | 43.49% | 15.61% | NA |
| Indica I | 595 | 4.40% | 1.00% | 20.17% | 74.45% | NA |
| Indica II | 465 | 3.40% | 2.20% | 10.54% | 83.87% | NA |
| Indica III | 913 | 4.20% | 0.90% | 4.60% | 90.36% | NA |
| Indica Intermediate | 786 | 7.30% | 0.90% | 11.07% | 80.79% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 95.40% | 0.00% | 3.17% | 1.39% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 60.00% | 0.00% | 5.56% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321495504 | T -> C | LOC_Os03g38730.1 | upstream_gene_variant ; 2553.0bp to feature; MODIFIER | silent_mutation | Average:24.307; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | N | N | N | N |
| vg0321495504 | T -> C | LOC_Os03g38730.2 | upstream_gene_variant ; 2553.0bp to feature; MODIFIER | silent_mutation | Average:24.307; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | N | N | N | N |
| vg0321495504 | T -> C | LOC_Os03g38730.3 | upstream_gene_variant ; 2553.0bp to feature; MODIFIER | silent_mutation | Average:24.307; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | N | N | N | N |
| vg0321495504 | T -> C | LOC_Os03g38720.1 | downstream_gene_variant ; 323.0bp to feature; MODIFIER | silent_mutation | Average:24.307; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | N | N | N | N |
| vg0321495504 | T -> C | LOC_Os03g38720-LOC_Os03g38730 | intergenic_region ; MODIFIER | silent_mutation | Average:24.307; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | N | N | N | N |
| vg0321495504 | T -> DEL | N | N | silent_mutation | Average:24.307; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321495504 | NA | 6.07E-15 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321495504 | NA | 4.51E-07 | mr1334 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321495504 | 1.88E-08 | 1.80E-91 | mr1718 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321495504 | 2.11E-06 | 2.69E-11 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321495504 | NA | 5.65E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321495504 | 1.77E-16 | 3.68E-137 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321495504 | 1.56E-16 | 2.51E-31 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321495504 | 1.35E-08 | 1.35E-08 | mr1987 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321495504 | NA | 7.54E-37 | mr1689_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321495504 | NA | 8.03E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321495504 | 1.10E-17 | 3.31E-137 | mr1718_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321495504 | 9.33E-14 | 1.16E-23 | mr1718_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321495504 | 8.59E-18 | 7.89E-175 | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321495504 | 4.55E-16 | 4.94E-45 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321495504 | NA | 9.23E-09 | mr1987_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |