Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0321495504:

Variant ID: vg0321495504 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 21495504
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.03, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

CTTAGTTATGCTACTTTCTCCATTTTAAAATATAAAAATCTAGTACCGAATGATATATTTTCTATTACTATGAATATGTATCTATAGAAAATGTTTTATT[T/C]
AAATTTAGGTTATTATATTTTAAGACGTAGGTGACATCTAAATACCGTTAGTATGGATTTATTGCTTGAAGTTGCCAACGTGTGGTACGTGTGTGCCATA

Reverse complement sequence

TATGGCACACACGTACCACACGTTGGCAACTTCAAGCAATAAATCCATACTAACGGTATTTAGATGTCACCTACGTCTTAAAATATAATAACCTAAATTT[A/G]
AATAAAACATTTTCTATAGATACATATTCATAGTAATAGAAAATATATCATTCGGTACTAGATTTTTATATTTTAAAATGGAGAAAGTAGCATAACTAAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.70%	0.70%	9.23%	50.34%	NA
All Indica	2759	5.00%	1.10%	10.80%	83.11%	NA
All Japonica	1512	98.30%	0.00%	1.06%	0.60%	NA
Aus	269	39.40%	1.50%	43.49%	15.61%	NA
Indica I	595	4.40%	1.00%	20.17%	74.45%	NA
Indica II	465	3.40%	2.20%	10.54%	83.87%	NA
Indica III	913	4.20%	0.90%	4.60%	90.36%	NA
Indica Intermediate	786	7.30%	0.90%	11.07%	80.79%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	95.40%	0.00%	3.17%	1.39%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	95.80%	0.00%	0.00%	4.17%	NA
Intermediate	90	60.00%	0.00%	5.56%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0321495504	T -> C	LOC_Os03g38730.1	upstream_gene_variant ; 2553.0bp to feature; MODIFIER	silent_mutation	Average:24.307; most accessible tissue: Zhenshan97 flag leaf, score: 68.703	N	N	N	N
vg0321495504	T -> C	LOC_Os03g38730.2	upstream_gene_variant ; 2553.0bp to feature; MODIFIER	silent_mutation	Average:24.307; most accessible tissue: Zhenshan97 flag leaf, score: 68.703	N	N	N	N
vg0321495504	T -> C	LOC_Os03g38730.3	upstream_gene_variant ; 2553.0bp to feature; MODIFIER	silent_mutation	Average:24.307; most accessible tissue: Zhenshan97 flag leaf, score: 68.703	N	N	N	N
vg0321495504	T -> C	LOC_Os03g38720.1	downstream_gene_variant ; 323.0bp to feature; MODIFIER	silent_mutation	Average:24.307; most accessible tissue: Zhenshan97 flag leaf, score: 68.703	N	N	N	N
vg0321495504	T -> C	LOC_Os03g38720-LOC_Os03g38730	intergenic_region ; MODIFIER	silent_mutation	Average:24.307; most accessible tissue: Zhenshan97 flag leaf, score: 68.703	N	N	N	N
vg0321495504	T -> DEL	N	N	silent_mutation	Average:24.307; most accessible tissue: Zhenshan97 flag leaf, score: 68.703	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0321495504	NA	6.07E-15	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504	NA	4.51E-07	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504	1.88E-08	1.80E-91	mr1718	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504	2.11E-06	2.69E-11	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504	NA	5.65E-12	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504	1.77E-16	3.68E-137	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504	1.56E-16	2.51E-31	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504	1.35E-08	1.35E-08	mr1987	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504	NA	7.54E-37	mr1689_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504	NA	8.03E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504	1.10E-17	3.31E-137	mr1718_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504	9.33E-14	1.16E-23	mr1718_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504	8.59E-18	7.89E-175	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504	4.55E-16	4.94E-45	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321495504	NA	9.23E-09	mr1987_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251