\
| Variant ID: vg0321444070 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21444070 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 200. )
GCGCCTCAATACCACCACGGTACCTCGAAAAGGAGCTGTGACAGTACCCCTCGCATAACACAATCCACCACAACGCATTGTTCCTGGATCATAATCACCC[T/C]
CTTATAAACAAGGCATGGACTCCCCAGCGACCCCCGTGGGCTTATCTCCGCCACTTCTCAGTCTGGTGCCCCGCAATGAACCATGTTATACAAAAGGTAA
TTACCTTTTGTATAACATGGTTCATTGCGGGGCACCAGACTGAGAAGTGGCGGAGATAAGCCCACGGGGGTCGCTGGGGAGTCCATGCCTTGTTTATAAG[A/G]
GGGTGATTATGATCCAGGAACAATGCGTTGTGGTGGATTGTGTTATGCGAGGGGTACTGTCACAGCTCCTTTTCGAGGTACCGTGGTGGTATTGAGGCGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.80% | 33.00% | 0.00% | 0.17% | NA |
| All Indica | 2759 | 98.10% | 1.70% | 0.00% | 0.22% | NA |
| All Japonica | 1512 | 9.00% | 91.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.60% | 0.00% | 0.22% | NA |
| Indica III | 913 | 98.80% | 1.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 97.50% | 2.00% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 9.10% | 90.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 34.00% | 66.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 48.90% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321444070 | T -> C | LOC_Os03g38620-LOC_Os03g38640 | intergenic_region ; MODIFIER | silent_mutation | Average:51.038; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| vg0321444070 | T -> DEL | N | N | silent_mutation | Average:51.038; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321444070 | NA | 2.34E-06 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321444070 | NA | 3.25E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321444070 | NA | 6.53E-36 | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321444070 | NA | 2.85E-11 | mr1713 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321444070 | NA | 6.29E-06 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321444070 | 5.39E-11 | 6.82E-139 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321444070 | NA | 7.86E-12 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321444070 | NA | 4.08E-22 | mr1839 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321444070 | NA | 4.54E-39 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321444070 | NA | 1.74E-06 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321444070 | NA | 3.99E-06 | mr1932 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321444070 | NA | 1.46E-98 | mr1987 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321444070 | 3.59E-07 | 1.12E-166 | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321444070 | NA | 2.07E-14 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321444070 | NA | 1.80E-10 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |