Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0321437947:

Variant ID: vg0321437947 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21437947
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, A: 0.22, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


CATTTATGCACTCTTACGTCATATCTAAACATGGAGGAATACAAAGGACATACATGGCTATCAGCACCCGCCGCCTACCTCACTTTTCGTGAGGCTAGGC[C/A]
ACCCGCATCCAACAACATTTATCTAACCTAAGCAGCATGCTTATGCCAATAAATAATATTACTAACTCCCAAGGGGCTCCCACCCTTCGGATGGACAAGT

Reverse complement sequence

ACTTGTCCATCCGAAGGGTGGGAGCCCCTTGGGAGTTAGTAATATTATTTATTGGCATAAGCATGCTGCTTAGGTTAGATAAATGTTGTTGGATGCGGGT[G/T]
GCCTAGCCTCACGAAAAGTGAGGTAGGCGGCGGGTGCTGATAGCCATGTATGTCCTTTGTATTCCTCCATGTTTAGATATGACGTAAGAGTGCATAAATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.50% 35.00% 0.06% 0.44% NA
All Indica  2759 48.90% 50.30% 0.07% 0.72% NA
All Japonica  1512 98.50% 1.50% 0.00% 0.00% NA
Aus  269 17.10% 82.90% 0.00% 0.00% NA
Indica I  595 37.30% 62.40% 0.00% 0.34% NA
Indica II  465 75.30% 24.30% 0.00% 0.43% NA
Indica III  913 48.00% 51.40% 0.11% 0.55% NA
Indica Intermediate  786 43.10% 55.30% 0.13% 1.40% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 95.80% 4.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 77.80% 20.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321437947 C -> A LOC_Os03g38620.1 downstream_gene_variant ; 3953.0bp to feature; MODIFIER silent_mutation Average:57.514; most accessible tissue: Zhenshan97 young leaf, score: 69.263 N N N N
vg0321437947 C -> A LOC_Os03g38620-LOC_Os03g38640 intergenic_region ; MODIFIER silent_mutation Average:57.514; most accessible tissue: Zhenshan97 young leaf, score: 69.263 N N N N
vg0321437947 C -> DEL N N silent_mutation Average:57.514; most accessible tissue: Zhenshan97 young leaf, score: 69.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321437947 NA 1.30E-07 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437947 NA 7.76E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437947 NA 3.03E-07 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437947 NA 4.03E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437947 NA 2.71E-12 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437947 2.54E-09 6.76E-87 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437947 5.53E-10 1.04E-13 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437947 1.64E-16 5.54E-133 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437947 5.20E-20 2.17E-33 mr1750 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437947 NA 4.30E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437947 2.19E-06 NA mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437947 6.38E-09 6.37E-09 mr1987 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437947 NA 9.31E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437947 1.25E-07 6.48E-113 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437947 9.69E-07 7.71E-14 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437947 8.17E-15 9.46E-168 mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437947 1.39E-12 1.08E-38 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437947 NA 7.54E-09 mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251