\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321437873:

Variant ID: vg0321437873 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21437873
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCTAGGACTTAGTTCTAGACACCCAATACTACCGAGAGATCACTCTCTACTGGTCTACCAGCGTGCTTATGGCATTTATGCACTCTTACGTCATATCT[A/G]
AACATGGAGGAATACAAAGGACATACATGGCTATCAGCACCCGCCGCCTACCTCACTTTTCGTGAGGCTAGGCCACCCGCATCCAACAACATTTATCTAA

Reverse complement sequence

TTAGATAAATGTTGTTGGATGCGGGTGGCCTAGCCTCACGAAAAGTGAGGTAGGCGGCGGGTGCTGATAGCCATGTATGTCCTTTGTATTCCTCCATGTT[T/C]
AGATATGACGTAAGAGTGCATAAATGCCATAAGCACGCTGGTAGACCAGTAGAGAGTGATCTCTCGGTAGTATTGGGTGTCTAGAACTAAGTCCTAGCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 32.90% 0.06% 0.06% NA
All Indica  2759 98.20% 1.60% 0.04% 0.11% NA
All Japonica  1512 8.90% 91.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.50% 1.30% 0.00% 0.17% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.80% 1.10% 0.00% 0.11% NA
Indica Intermediate  786 97.80% 1.90% 0.13% 0.13% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 9.10% 90.90% 0.00% 0.00% NA
Japonica Intermediate  241 34.00% 66.00% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 51.10% 46.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321437873 A -> DEL N N silent_mutation Average:54.676; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 N N N N
vg0321437873 A -> G LOC_Os03g38620.1 downstream_gene_variant ; 3879.0bp to feature; MODIFIER silent_mutation Average:54.676; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 N N N N
vg0321437873 A -> G LOC_Os03g38620-LOC_Os03g38640 intergenic_region ; MODIFIER silent_mutation Average:54.676; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321437873 NA 4.10E-19 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437873 NA 6.11E-26 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437873 NA 4.03E-40 mr1670 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437873 NA 5.98E-61 mr1711 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437873 3.63E-06 3.34E-83 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437873 5.28E-15 2.47E-159 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437873 NA 6.07E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437873 NA 7.84E-17 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437873 NA 2.11E-42 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437873 NA 1.53E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437873 NA 1.14E-53 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437873 NA 1.43E-110 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437873 NA 2.22E-18 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437873 2.95E-06 2.66E-120 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437873 1.03E-12 3.16E-207 mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321437873 NA 1.72E-16 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251