\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321402881:

Variant ID: vg0321402881 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21402881
Reference Allele: CAlternative Allele: T,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AGACCTGGTTAACGACCAGCTGGGAGTCGCCTAACACCATGAGGCGGCGGATCCCCAGTCCAGCTGCCACCCTGAGTCCCGCAAGGAGTCCCTCGTACTC[C/T,G]
GCCATATTATTGGTCGCCCGAAAATCGAGGCGAACCAAGTATCTGAGGACGTCTCCGCTCGGCGAGGTCAACGTGACCCCCGCACCGGCGCCCTGAAGAG

Reverse complement sequence

CTCTTCAGGGCGCCGGTGCGGGGGTCACGTTGACCTCGCCGAGCGGAGACGTCCTCAGATACTTGGTTCGCCTCGATTTTCGGGCGACCAATAATATGGC[G/A,C]
GAGTACGAGGGACTCCTTGCGGGACTCAGGGTGGCAGCTGGACTGGGGATCCGCCGCCTCATGGTGTTAGGCGACTCCCAGCTGGTCGTTAACCAGGTCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.70% 35.60% 1.42% 0.28% G: 0.04%
All Indica  2759 95.80% 2.00% 1.70% 0.36% G: 0.07%
All Japonica  1512 0.70% 98.10% 0.93% 0.20% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 97.30% 1.30% 1.18% 0.00% G: 0.17%
Indica II  465 93.80% 2.80% 2.58% 0.86% NA
Indica III  913 96.80% 1.60% 1.42% 0.11% NA
Indica Intermediate  786 94.80% 2.50% 1.91% 0.64% G: 0.13%
Temperate Japonica  767 0.40% 99.30% 0.13% 0.13% NA
Tropical Japonica  504 1.40% 95.80% 2.38% 0.40% NA
Japonica Intermediate  241 0.40% 99.20% 0.41% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 38.90% 54.40% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321402881 C -> T LOC_Os03g38570.1 synonymous_variant ; p.Ala1453Ala; LOW synonymous_codon Average:46.465; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N
vg0321402881 C -> T LOC_Os03g38570.1 synonymous_variant ; p.Ala1453Ala; LOW nonsynonymous_codon ; A1453V Average:46.465; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 benign 0.725 DELETERIOUS 0.01
vg0321402881 C -> DEL LOC_Os03g38570.1 N frameshift_variant Average:46.465; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N
vg0321402881 C -> G LOC_Os03g38570.1 synonymous_variant ; p.Ala1453Ala; LOW synonymous_codon Average:46.465; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321402881 NA 2.31E-25 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321402881 NA 9.28E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321402881 NA 3.53E-06 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321402881 NA 1.35E-07 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321402881 3.97E-07 2.29E-125 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321402881 8.26E-07 5.28E-14 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321402881 NA 3.41E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321402881 NA 5.46E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321402881 8.49E-07 1.24E-154 mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321402881 1.65E-07 8.98E-18 mr1750_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251