\
| Variant ID: vg0321402881 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21402881 |
| Reference Allele: C | Alternative Allele: T,G |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 103. )
AGACCTGGTTAACGACCAGCTGGGAGTCGCCTAACACCATGAGGCGGCGGATCCCCAGTCCAGCTGCCACCCTGAGTCCCGCAAGGAGTCCCTCGTACTC[C/T,G]
GCCATATTATTGGTCGCCCGAAAATCGAGGCGAACCAAGTATCTGAGGACGTCTCCGCTCGGCGAGGTCAACGTGACCCCCGCACCGGCGCCCTGAAGAG
CTCTTCAGGGCGCCGGTGCGGGGGTCACGTTGACCTCGCCGAGCGGAGACGTCCTCAGATACTTGGTTCGCCTCGATTTTCGGGCGACCAATAATATGGC[G/A,C]
GAGTACGAGGGACTCCTTGCGGGACTCAGGGTGGCAGCTGGACTGGGGATCCGCCGCCTCATGGTGTTAGGCGACTCCCAGCTGGTCGTTAACCAGGTCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.70% | 35.60% | 1.42% | 0.28% | G: 0.04% |
| All Indica | 2759 | 95.80% | 2.00% | 1.70% | 0.36% | G: 0.07% |
| All Japonica | 1512 | 0.70% | 98.10% | 0.93% | 0.20% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 1.30% | 1.18% | 0.00% | G: 0.17% |
| Indica II | 465 | 93.80% | 2.80% | 2.58% | 0.86% | NA |
| Indica III | 913 | 96.80% | 1.60% | 1.42% | 0.11% | NA |
| Indica Intermediate | 786 | 94.80% | 2.50% | 1.91% | 0.64% | G: 0.13% |
| Temperate Japonica | 767 | 0.40% | 99.30% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 1.40% | 95.80% | 2.38% | 0.40% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 54.40% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321402881 | C -> T | LOC_Os03g38570.1 | synonymous_variant ; p.Ala1453Ala; LOW | synonymous_codon | Average:46.465; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 | N | N | N | N |
| vg0321402881 | C -> T | LOC_Os03g38570.1 | synonymous_variant ; p.Ala1453Ala; LOW | nonsynonymous_codon ; A1453V | Average:46.465; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 | benign |
0.725 |
DELETERIOUS | 0.01 |
| vg0321402881 | C -> DEL | LOC_Os03g38570.1 | N | frameshift_variant | Average:46.465; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 | N | N | N | N |
| vg0321402881 | C -> G | LOC_Os03g38570.1 | synonymous_variant ; p.Ala1453Ala; LOW | synonymous_codon | Average:46.465; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321402881 | NA | 2.31E-25 | mr1024 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321402881 | NA | 9.28E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321402881 | NA | 3.53E-06 | mr1334 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321402881 | NA | 1.35E-07 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321402881 | 3.97E-07 | 2.29E-125 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321402881 | 8.26E-07 | 5.28E-14 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321402881 | NA | 3.41E-16 | mr1842 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321402881 | NA | 5.46E-23 | mr1708_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321402881 | 8.49E-07 | 1.24E-154 | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321402881 | 1.65E-07 | 8.98E-18 | mr1750_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |