\
| Variant ID: vg0321273503 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21273503 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 154. )
TATCTAATGTGGCGTCTATGTGAAACTTATACGATAAAACAACAACAACAAAAAAAAGTGGGTCAACGTACATGTAATCCATAGAGAAGAAATATAGTGT[G/A]
CATATGGCGGGACTATATATTTAAAGTGGTTTTAGAAGATGAGGGGCACTATCCAAACTCAACCGTTATATGCGGAAGAGTAAATTGCACTAGCGGTCCT
AGGACCGCTAGTGCAATTTACTCTTCCGCATATAACGGTTGAGTTTGGATAGTGCCCCTCATCTTCTAAAACCACTTTAAATATATAGTCCCGCCATATG[C/T]
ACACTATATTTCTTCTCTATGGATTACATGTACGTTGACCCACTTTTTTTTGTTGTTGTTGTTTTATCGTATAAGTTTCACATAGACGCCACATTAGATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.20% | 35.60% | 0.06% | 0.17% | NA |
| All Indica | 2759 | 97.60% | 2.20% | 0.04% | 0.14% | NA |
| All Japonica | 1512 | 1.70% | 98.30% | 0.00% | 0.07% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.20% | 0.00% | 0.17% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.10% | 1.80% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 96.40% | 3.20% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.40% | 95.40% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 94.80% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 47.80% | 47.80% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321273503 | G -> A | LOC_Os03g38330.1 | downstream_gene_variant ; 1091.0bp to feature; MODIFIER | silent_mutation | Average:85.8; most accessible tissue: Callus, score: 95.763 | N | N | N | N |
| vg0321273503 | G -> A | LOC_Os03g38350.1 | downstream_gene_variant ; 1896.0bp to feature; MODIFIER | silent_mutation | Average:85.8; most accessible tissue: Callus, score: 95.763 | N | N | N | N |
| vg0321273503 | G -> A | LOC_Os03g38330-LOC_Os03g38350 | intergenic_region ; MODIFIER | silent_mutation | Average:85.8; most accessible tissue: Callus, score: 95.763 | N | N | N | N |
| vg0321273503 | G -> DEL | N | N | silent_mutation | Average:85.8; most accessible tissue: Callus, score: 95.763 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321273503 | NA | 6.26E-14 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | NA | 6.26E-14 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | NA | 1.18E-35 | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | NA | 2.36E-11 | mr1713 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | 1.55E-13 | 5.33E-95 | mr1718 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | 5.23E-22 | 2.00E-170 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | NA | 3.65E-17 | mr1842 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | 6.22E-06 | 3.59E-116 | mr1987 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | NA | 2.01E-16 | mr1342_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | NA | 1.30E-10 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | NA | 2.14E-36 | mr1541_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | NA | 2.81E-24 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | NA | 1.88E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | NA | 1.03E-36 | mr1689_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | NA | 1.13E-13 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | 3.20E-19 | 1.66E-142 | mr1718_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | 2.23E-34 | 1.47E-238 | mr1750_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | NA | 1.69E-16 | mr1842_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | NA | 1.59E-10 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | NA | 2.60E-22 | mr1933_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321273503 | 2.91E-06 | 9.34E-157 | mr1987_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |