\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321218638:

Variant ID: vg0321218638 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21218638
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.25, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTACCTAATCCCTTCTATACCCCTGAATTTTGCTTACTTTCTTGTATACCCCCAAAATTTGATTTTGATTCCTTCCATACCCCTCCCGTCAGCTAAC[C/T]
GTTAGTTGGCCATCTAATTTCTATAAAAATAACCATTTTACCCTTTGGATGAACATAGAAATTTATGAATTACATTATTAAAAATGTAAAAGTTTGTCGC

Reverse complement sequence

GCGACAAACTTTTACATTTTTAATAATGTAATTCATAAATTTCTATGTTCATCCAAAGGGTAAAATGGTTATTTTTATAGAAATTAGATGGCCAACTAAC[G/A]
GTTAGCTGACGGGAGGGGTATGGAAGGAATCAAAATCAAATTTTGGGGGTATACAAGAAAGTAAGCAAAATTCAGGGGTATAGAAGGGATTAGGTAAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 35.90% 0.51% 0.49% NA
All Indica  2759 95.70% 2.70% 0.83% 0.83% NA
All Japonica  1512 1.80% 98.20% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 97.00% 1.70% 1.01% 0.34% NA
Indica II  465 96.30% 3.40% 0.00% 0.22% NA
Indica III  913 95.30% 1.90% 0.99% 1.86% NA
Indica Intermediate  786 94.70% 3.90% 1.02% 0.38% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 4.40% 95.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 50.00% 48.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321218638 C -> T LOC_Os03g38210.1 downstream_gene_variant ; 2837.0bp to feature; MODIFIER silent_mutation Average:28.067; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0321218638 C -> T LOC_Os03g38210-LOC_Os03g38230 intergenic_region ; MODIFIER silent_mutation Average:28.067; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0321218638 C -> DEL N N silent_mutation Average:28.067; most accessible tissue: Minghui63 root, score: 38.567 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321218638 NA 3.17E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 NA 1.99E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 NA 1.57E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 NA 5.91E-06 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 NA 6.90E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 NA 3.41E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 NA 1.51E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 NA 2.69E-78 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 NA 2.74E-08 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 6.93E-13 3.22E-151 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 4.98E-08 9.60E-19 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 NA 8.31E-107 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 1.90E-06 1.90E-06 mr1987 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 NA 1.23E-24 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 9.36E-07 1.47E-117 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 NA 5.59E-14 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 2.55E-12 3.50E-194 mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 2.84E-07 4.38E-25 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 5.45E-07 NA mr1987_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321218638 4.95E-07 1.28E-09 mr1987_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251