\
| Variant ID: vg0321208630 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21208630 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 236. )
GGTTGTTATGACGGTTGTAGCCTATGCGAAATGACCAATATGCCTGCAACCATCATTGGGGAGCGATCAAGAGCGTCCAGGTGTAAGGCCAGCCAGAGCC[A/G]
GCGTCACCAGGGTTCGCAGCAGGCCTCCAAACTTCCCTATGTGGTTGACAGGTGGGTCCCTATGGCGGTTGTGACAGTTATGACGGTTTCCGGGACGGTT
AACCGTCCCGGAAACCGTCATAACTGTCACAACCGCCATAGGGACCCACCTGTCAACCACATAGGGAAGTTTGGAGGCCTGCTGCGAACCCTGGTGACGC[T/C]
GGCTCTGGCTGGCCTTACACCTGGACGCTCTTGATCGCTCCCCAATGATGGTTGCAGGCATATTGGTCATTTCGCATAGGCTACAACCGTCATAACAACC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.50% | 43.00% | 0.11% | 0.38% | NA |
| All Indica | 2759 | 40.60% | 58.70% | 0.07% | 0.62% | NA |
| All Japonica | 1512 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 0.70% | 98.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 25.20% | 74.50% | 0.00% | 0.34% | NA |
| Indica II | 465 | 23.70% | 76.10% | 0.00% | 0.22% | NA |
| Indica III | 913 | 51.50% | 47.60% | 0.11% | 0.77% | NA |
| Indica Intermediate | 786 | 49.60% | 49.40% | 0.13% | 0.89% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 41.10% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321208630 | A -> DEL | LOC_Os03g38190.1 | N | frameshift_variant | Average:50.045; most accessible tissue: Zhenshan97 young leaf, score: 68.315 | N | N | N | N |
| vg0321208630 | A -> G | LOC_Os03g38190.1 | missense_variant ; p.Gln136Arg; MODERATE | nonsynonymous_codon ; Q136R | Average:50.045; most accessible tissue: Zhenshan97 young leaf, score: 68.315 | unknown | unknown | TOLERATED | 0.20 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321208630 | NA | 2.88E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321208630 | NA | 2.67E-10 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321208630 | NA | 9.70E-11 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321208630 | NA | 2.64E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321208630 | NA | 4.98E-13 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321208630 | NA | 2.51E-07 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321208630 | NA | 2.61E-18 | mr1653 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321208630 | NA | 5.33E-06 | mr1653 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321208630 | NA | 2.32E-08 | mr1806 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321208630 | NA | 2.42E-16 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321208630 | NA | 6.43E-17 | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321208630 | NA | 7.88E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321208630 | NA | 5.32E-10 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321208630 | NA | 3.29E-16 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321208630 | NA | 8.75E-09 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321208630 | NA | 4.49E-08 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |