\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321163507:

Variant ID: vg0321163507 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21163507
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGGCACGGCCTGAAGAGATGAGGGATGCAATGTAAACTTATTCAAGGATGAGCACGACGGGCTGTTTGTGCCTTCGGGTCGGCATGACATGGTATGGC[C/G]
CGAGTCTTATTGGATCGTACCTGGGCCGTAGGCGCAACCTGTGGGCGAGCACGGCATAACACAACGAGTTGGTCAGGGCGTGCCTTGGTTGGCAGCCCAT

Reverse complement sequence

ATGGGCTGCCAACCAAGGCACGCCCTGACCAACTCGTTGTGTTATGCCGTGCTCGCCCACAGGTTGCGCCTACGGCCCAGGTACGATCCAATAAGACTCG[G/C]
GCCATACCATGTCATGCCGACCCGAAGGCACAAACAGCCCGTCGTGCTCATCCTTGAATAAGTTTACATTGCATCCCTCATCTCTTCAGGCCGTGCCTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.30% 18.50% 0.21% 0.02% NA
All Indica  2759 77.70% 21.90% 0.33% 0.04% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 4.50% 95.20% 0.37% 0.00% NA
Indica I  595 28.40% 71.30% 0.34% 0.00% NA
Indica II  465 94.80% 4.70% 0.43% 0.00% NA
Indica III  913 95.60% 4.40% 0.00% 0.00% NA
Indica Intermediate  786 84.10% 15.10% 0.64% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321163507 C -> DEL N N silent_mutation Average:96.944; most accessible tissue: Zhenshan97 flower, score: 98.253 N N N N
vg0321163507 C -> G LOC_Os03g38110.1 downstream_gene_variant ; 4903.0bp to feature; MODIFIER silent_mutation Average:96.944; most accessible tissue: Zhenshan97 flower, score: 98.253 N N N N
vg0321163507 C -> G LOC_Os03g38110-LOC_Os03g38120 intergenic_region ; MODIFIER silent_mutation Average:96.944; most accessible tissue: Zhenshan97 flower, score: 98.253 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0321163507 C G -0.28 -0.28 -0.28 -0.24 -0.25 -0.25

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321163507 NA 8.80E-21 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0321163507 NA 9.46E-08 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0321163507 NA 5.84E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321163507 NA 1.81E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321163507 NA 3.26E-09 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321163507 NA 3.93E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321163507 NA 6.91E-06 mr1367 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321163507 NA 4.81E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321163507 NA 6.81E-09 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321163507 NA 1.85E-11 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321163507 NA 1.70E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321163507 NA 5.95E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321163507 NA 5.58E-10 mr1857 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321163507 NA 1.16E-07 mr1857 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321163507 NA 2.77E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321163507 NA 3.66E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321163507 NA 8.57E-06 mr1928 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321163507 NA 7.82E-09 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321163507 NA 3.35E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251