Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0321143949:

Variant ID: vg0321143949 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 21143949
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCAGGTCACGAATGACTGGATTTTGCGGACGTACGTGGCACAAGGGAATGGCTGGTGGGATCTGCATTTCCCACGTTCATATTGATGTTAATGAATTTT[C/T]
CCACATTTATATTGATGTTATTTATTTAGATTCATTAACATCAATATAAATGTGGGAAATGCTAGAATGACTTACATTGTGAAATCCTCCATTTCACAAT

Reverse complement sequence

ATTGTGAAATGGAGGATTTCACAATGTAAGTCATTCTAGCATTTCCCACATTTATATTGATGTTAATGAATCTAAATAAATAACATCAATATAAATGTGG[G/A]
AAAATTCATTAACATCAATATGAACGTGGGAAATGCAGATCCCACCAGCCATTCCCTTGTGCCACGTACGTCCGCAAAATCCAGTCATTCGTGACCTGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.20%	47.90%	0.47%	0.44%	NA
All Indica	2759	85.10%	13.60%	0.58%	0.76%	NA
All Japonica	1512	1.50%	98.10%	0.33%	0.00%	NA
Aus	269	3.00%	97.00%	0.00%	0.00%	NA
Indica I	595	63.70%	35.60%	0.50%	0.17%	NA
Indica II	465	95.70%	4.10%	0.22%	0.00%	NA
Indica III	913	91.50%	6.00%	0.77%	1.75%	NA
Indica Intermediate	786	87.50%	11.30%	0.64%	0.51%	NA
Temperate Japonica	767	0.90%	99.00%	0.13%	0.00%	NA
Tropical Japonica	504	1.60%	98.40%	0.00%	0.00%	NA
Japonica Intermediate	241	3.30%	95.00%	1.66%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	37.80%	61.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0321143949	C -> T	LOC_Os03g38082.1	upstream_gene_variant ; 2211.0bp to feature; MODIFIER	silent_mutation	Average:52.91; most accessible tissue: Zhenshan97 flower, score: 78.677	N	N	N	N
vg0321143949	C -> T	LOC_Os03g38090.1	upstream_gene_variant ; 653.0bp to feature; MODIFIER	silent_mutation	Average:52.91; most accessible tissue: Zhenshan97 flower, score: 78.677	N	N	N	N
vg0321143949	C -> T	LOC_Os03g38094.1	downstream_gene_variant ; 2414.0bp to feature; MODIFIER	silent_mutation	Average:52.91; most accessible tissue: Zhenshan97 flower, score: 78.677	N	N	N	N
vg0321143949	C -> T	LOC_Os03g38082-LOC_Os03g38090	intergenic_region ; MODIFIER	silent_mutation	Average:52.91; most accessible tissue: Zhenshan97 flower, score: 78.677	N	N	N	N
vg0321143949	C -> DEL	N	N	silent_mutation	Average:52.91; most accessible tissue: Zhenshan97 flower, score: 78.677	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0321143949	NA	1.71E-06	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321143949	NA	2.19E-06	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321143949	NA	5.32E-09	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321143949	NA	2.56E-25	mr1551	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321143949	NA	2.94E-09	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321143949	NA	1.28E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321143949	NA	1.86E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321143949	NA	5.63E-09	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321143949	NA	4.41E-16	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321143949	NA	8.92E-23	mr1183_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321143949	NA	2.59E-07	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321143949	NA	8.39E-08	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321143949	NA	1.07E-18	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321143949	NA	1.43E-07	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321143949	NA	7.85E-06	mr1696_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321143949	3.34E-10	NA	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321143949	2.94E-08	1.85E-13	mr1750_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321143949	NA	6.06E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251