\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321136492:

Variant ID: vg0321136492 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21136492
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


GGCTACAAAGAGATGAGTATAACTACCGACAGCCTTTTTAAATGGACCAACCATGTCGAGCCCCCAAACCGCGAACGACCAAGACAACGGGATGGTTTGC[A/G]
ACTCTTGAGCCGGTAGATGAGTTTGTCGGGCGAAAAATTGACAACCCTCACATGTTCGCACAATTTTGTCGGCGTCGGACACAGCTGTGGGCCAGAAAAA

Reverse complement sequence

TTTTTCTGGCCCACAGCTGTGTCCGACGCCGACAAAATTGTGCGAACATGTGAGGGTTGTCAATTTTTCGCCCGACAAACTCATCTACCGGCTCAAGAGT[T/C]
GCAAACCATCCCGTTGTCTTGGTCGTTCGCGGTTTGGGGGCTCGACATGGTTGGTCCATTTAAAAAGGCTGTCGGTAGTTATACTCATCTCTTTGTAGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 17.80% 0.40% 0.02% NA
All Indica  2759 78.50% 20.80% 0.65% 0.04% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 5.90% 93.70% 0.37% 0.00% NA
Indica I  595 30.60% 67.70% 1.68% 0.00% NA
Indica II  465 94.80% 4.70% 0.43% 0.00% NA
Indica III  913 95.60% 4.20% 0.11% 0.11% NA
Indica Intermediate  786 85.10% 14.20% 0.64% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321136492 A -> DEL N N silent_mutation Average:42.324; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0321136492 A -> G LOC_Os03g38070.1 downstream_gene_variant ; 1315.0bp to feature; MODIFIER silent_mutation Average:42.324; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0321136492 A -> G LOC_Os03g38082.1 downstream_gene_variant ; 2465.0bp to feature; MODIFIER silent_mutation Average:42.324; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0321136492 A -> G LOC_Os03g38076.1 intron_variant ; MODIFIER silent_mutation Average:42.324; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321136492 NA 6.41E-13 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0321136492 NA 1.06E-07 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321136492 NA 2.05E-10 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321136492 NA 2.33E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321136492 NA 1.33E-07 mr1367 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321136492 NA 3.54E-10 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321136492 NA 7.53E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321136492 NA 2.60E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321136492 NA 5.46E-06 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321136492 NA 6.10E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321136492 NA 7.23E-06 mr1831 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321136492 NA 5.89E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321136492 NA 3.79E-06 mr1857 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321136492 NA 4.03E-07 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321136492 NA 1.04E-06 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321136492 4.32E-07 4.32E-07 mr1978 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321136492 4.87E-06 4.87E-06 mr1978 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321136492 NA 1.63E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251