Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321123982:

Variant ID: vg0321123982 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 21123982
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

CAAAATTTATCACAAAAAATATTTTAGTATTAATTTGAAAGCAGTACTACCTCTATCCCAAAATAAGCGCAGCCATAAGTTTCCGTGTCCAATTTTAATT[G/A]
TCCGTCTTGTTTGAAATATTTTTATGATTAGTATTTTTATTATTACTAGAATATAAAACATGAATAGTATTTTATCTGTGATTTATATTTTTTTAGTTTT

Reverse complement sequence

AAAACTAAAAAAATATAAATCACAGATAAAATACTATTCATGTTTTATATTCTAGTAATAATAAAAATACTAATCATAAAAATATTTCAAACAAGACGGA[C/T]
AATTAAAATTGGACACGGAAACTTATGGCTGCGCTTATTTTGGGATAGAGGTAGTACTGCTTTCAAATTAATACTAAAATATTTTTTGTGATAAATTTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.40%	44.50%	0.13%	0.00%	NA
All Indica	2759	25.30%	74.50%	0.18%	0.00%	NA
All Japonica	1512	99.20%	0.80%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	73.80%	25.70%	0.50%	0.00%	NA
Indica II	465	7.30%	92.50%	0.22%	0.00%	NA
Indica III	913	7.60%	92.40%	0.00%	0.00%	NA
Indica Intermediate	786	19.80%	80.00%	0.13%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	65.60%	33.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0321123982	G -> A	LOC_Os03g38050.1	upstream_gene_variant ; 526.0bp to feature; MODIFIER	silent_mutation	Average:62.981; most accessible tissue: Zhenshan97 flower, score: 84.504	N	N	N	N
vg0321123982	G -> A	LOC_Os03g38050-LOC_Os03g38070	intergenic_region ; MODIFIER	silent_mutation	Average:62.981; most accessible tissue: Zhenshan97 flower, score: 84.504	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0321123982	NA	2.20E-15	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0321123982	NA	3.16E-15	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0321123982	NA	3.86E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321123982	NA	5.67E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321123982	NA	2.40E-06	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321123982	NA	5.07E-06	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321123982	NA	1.03E-10	mr1565	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321123982	NA	6.85E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321123982	NA	4.07E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321123982	NA	3.78E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321123982	NA	4.15E-08	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321123982	NA	9.95E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321123982	NA	9.29E-06	mr1749	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321123982	NA	8.04E-09	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321123982	NA	2.93E-06	mr1857	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321123982	NA	6.38E-09	mr1928	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321123982	NA	5.37E-07	mr1928	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321123982	NA	2.74E-06	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321123982	NA	6.02E-12	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321123982	NA	5.67E-12	mr1565_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251