Variant ID: vg0321057005 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 21057005 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )
GTACAGATTAATGCACACACCCAAATCCATTCTGAAAAGGCCTACTATTCATTGGAAAATGTAACTTTCTAGCAGACGAGGAAAATGTGCAATCTTGTTG[G/A]
ACTTCAAATAAAAGATTTGTATATCCGCCTTGGATCAAAGGAGTAGGCATGGTCGAAGATTCACCATATACATCATTTGCAACCATGGTTGAAGATTGCC
GGCAATCTTCAACCATGGTTGCAAATGATGTATATGGTGAATCTTCGACCATGCCTACTCCTTTGATCCAAGGCGGATATACAAATCTTTTATTTGAAGT[C/T]
CAACAAGATTGCACATTTTCCTCGTCTGCTAGAAAGTTACATTTTCCAATGAATAGTAGGCCTTTTCAGAATGGATTTGGGTGTGTGCATTAATCTGTAC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 93.80% | 5.00% | 1.16% | 0.00% | NA |
All Indica | 2759 | 99.70% | 0.30% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 81.50% | 15.00% | 3.44% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.90% | 0.90% | 0.22% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 65.80% | 28.30% | 5.87% | 0.00% | NA |
Tropical Japonica | 504 | 99.20% | 0.20% | 0.60% | 0.00% | NA |
Japonica Intermediate | 241 | 94.60% | 3.70% | 1.66% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0321057005 | G -> A | LOC_Os03g37920.1 | 3_prime_UTR_variant ; 201.0bp to feature; MODIFIER | silent_mutation | Average:43.95; most accessible tissue: Callus, score: 85.284 | N | N | N | N |
vg0321057005 | G -> A | LOC_Os03g37915.1 | upstream_gene_variant ; 1478.0bp to feature; MODIFIER | silent_mutation | Average:43.95; most accessible tissue: Callus, score: 85.284 | N | N | N | N |
vg0321057005 | G -> A | LOC_Os03g37930.1 | downstream_gene_variant ; 3408.0bp to feature; MODIFIER | silent_mutation | Average:43.95; most accessible tissue: Callus, score: 85.284 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0321057005 | 5.14E-06 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0321057005 | NA | 3.72E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0321057005 | NA | 1.46E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0321057005 | NA | 4.40E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0321057005 | 4.21E-06 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0321057005 | NA | 1.22E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0321057005 | 6.05E-07 | NA | mr1765 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0321057005 | NA | 2.29E-08 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0321057005 | NA | 1.23E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0321057005 | NA | 3.33E-07 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0321057005 | NA | 5.50E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0321057005 | NA | 7.15E-06 | mr1793_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |