Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0320967721:

Variant ID: vg0320967721 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20967721
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

AGTAGTTGAAGAGTTTAGGAGTTTAATAGTTTAGCACTTTGAATTTTCTTGTATTTCAAATAAGGATGTATTAGTTTGGATCTTTTCACCCTTTAACAGT[G/T]
GTATAATTAGCCTGTATAAACAAATTTGTATAAATAATCGAAAGCTGTTCAGTATATCAATCTGTGCGTGATCGAAATCCTGGACGATCACGAGTGGATT

Reverse complement sequence

AATCCACTCGTGATCGTCCAGGATTTCGATCACGCACAGATTGATATACTGAACAGCTTTCGATTATTTATACAAATTTGTTTATACAGGCTAATTATAC[C/A]
ACTGTTAAAGGGTGAAAAGATCCAAACTAATACATCCTTATTTGAAATACAAGAAAATTCAAAGTGCTAAACTATTAAACTCCTAAACTCTTCAACTACT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.20%	35.40%	0.06%	0.34%	NA
All Indica	2759	97.50%	2.10%	0.07%	0.29%	NA
All Japonica	1512	3.40%	96.30%	0.00%	0.26%	NA
Aus	269	88.80%	11.20%	0.00%	0.00%	NA
Indica I	595	98.50%	0.80%	0.34%	0.34%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	98.70%	1.10%	0.00%	0.22%	NA
Indica Intermediate	786	95.40%	4.10%	0.00%	0.51%	NA
Temperate Japonica	767	0.30%	99.60%	0.00%	0.13%	NA
Tropical Japonica	504	9.50%	90.10%	0.00%	0.40%	NA
Japonica Intermediate	241	0.80%	98.80%	0.00%	0.41%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	51.10%	43.30%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320967721	G -> T	LOC_Os03g37820.1	upstream_gene_variant ; 2980.0bp to feature; MODIFIER	silent_mutation	Average:32.05; most accessible tissue: Zhenshan97 flag leaf, score: 39.979	N	N	N	N
vg0320967721	G -> T	LOC_Os03g37820-LOC_Os03g37830	intergenic_region ; MODIFIER	silent_mutation	Average:32.05; most accessible tissue: Zhenshan97 flag leaf, score: 39.979	N	N	N	N
vg0320967721	G -> DEL	N	N	silent_mutation	Average:32.05; most accessible tissue: Zhenshan97 flag leaf, score: 39.979	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320967721	NA	8.14E-20	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320967721	NA	2.34E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320967721	NA	2.27E-77	mr1718	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320967721	3.36E-08	2.60E-127	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320967721	NA	1.43E-06	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320967721	2.60E-06	2.60E-06	mr1918	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320967721	NA	6.93E-112	mr1718_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320967721	2.82E-11	4.12E-168	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320967721	1.09E-06	NA	mr1987_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251