\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320923321:

Variant ID: vg0320923321 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20923321
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


ATACAATAGTTGTAGATTTCAATAAGTTCTACAATTTTGTTATTTATGATTTTTGCATTTGAAACACAAAAATCAGCCTAAAATTAAATTTGAAGTTCTC[A/G]
TGAATTAAAATTAAAAAGTACGAGTAGCACAAGATCTTTAGTTTTTTTTTTTGCCAAAAATAAACATACTGGCAAGCGCCAAAATTTTCCGGCCAGGTTT

Reverse complement sequence

AAACCTGGCCGGAAAATTTTGGCGCTTGCCAGTATGTTTATTTTTGGCAAAAAAAAAAACTAAAGATCTTGTGCTACTCGTACTTTTTAATTTTAATTCA[T/C]
GAGAACTTCAAATTTAATTTTAGGCTGATTTTTGTGTTTCAAATGCAAAAATCATAAATAACAAAATTGTAGAACTTATTGAAATCTACAACTATTGTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 10.70% 2.31% 18.13% NA
All Indica  2759 50.90% 17.90% 3.77% 27.36% NA
All Japonica  1512 99.50% 0.10% 0.13% 0.20% NA
Aus  269 65.80% 0.40% 0.74% 33.09% NA
Indica I  595 41.70% 7.20% 5.55% 45.55% NA
Indica II  465 42.20% 38.50% 3.87% 15.48% NA
Indica III  913 61.90% 12.50% 2.96% 22.67% NA
Indica Intermediate  786 50.40% 20.20% 3.31% 26.08% NA
Temperate Japonica  767 99.60% 0.00% 0.13% 0.26% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 80.00% 7.80% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320923321 A -> DEL N N silent_mutation Average:13.679; most accessible tissue: Callus, score: 40.593 N N N N
vg0320923321 A -> G LOC_Os03g37730.1 upstream_gene_variant ; 260.0bp to feature; MODIFIER silent_mutation Average:13.679; most accessible tissue: Callus, score: 40.593 N N N N
vg0320923321 A -> G LOC_Os03g37736.1 downstream_gene_variant ; 2806.0bp to feature; MODIFIER silent_mutation Average:13.679; most accessible tissue: Callus, score: 40.593 N N N N
vg0320923321 A -> G LOC_Os03g37742.1 downstream_gene_variant ; 4205.0bp to feature; MODIFIER silent_mutation Average:13.679; most accessible tissue: Callus, score: 40.593 N N N N
vg0320923321 A -> G LOC_Os03g37720-LOC_Os03g37730 intergenic_region ; MODIFIER silent_mutation Average:13.679; most accessible tissue: Callus, score: 40.593 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320923321 NA 4.99E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320923321 3.02E-06 NA mr1943 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320923321 NA 3.12E-06 mr1943 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251