Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0320923321:

Variant ID: vg0320923321 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20923321
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

ATACAATAGTTGTAGATTTCAATAAGTTCTACAATTTTGTTATTTATGATTTTTGCATTTGAAACACAAAAATCAGCCTAAAATTAAATTTGAAGTTCTC[A/G]
TGAATTAAAATTAAAAAGTACGAGTAGCACAAGATCTTTAGTTTTTTTTTTTGCCAAAAATAAACATACTGGCAAGCGCCAAAATTTTCCGGCCAGGTTT

Reverse complement sequence

AAACCTGGCCGGAAAATTTTGGCGCTTGCCAGTATGTTTATTTTTGGCAAAAAAAAAAACTAAAGATCTTGTGCTACTCGTACTTTTTAATTTTAATTCA[T/C]
GAGAACTTCAAATTTAATTTTAGGCTGATTTTTGTGTTTCAAATGCAAAAATCATAAATAACAAAATTGTAGAACTTATTGAAATCTACAACTATTGTAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.90%	10.70%	2.31%	18.13%	NA
All Indica	2759	50.90%	17.90%	3.77%	27.36%	NA
All Japonica	1512	99.50%	0.10%	0.13%	0.20%	NA
Aus	269	65.80%	0.40%	0.74%	33.09%	NA
Indica I	595	41.70%	7.20%	5.55%	45.55%	NA
Indica II	465	42.20%	38.50%	3.87%	15.48%	NA
Indica III	913	61.90%	12.50%	2.96%	22.67%	NA
Indica Intermediate	786	50.40%	20.20%	3.31%	26.08%	NA
Temperate Japonica	767	99.60%	0.00%	0.13%	0.26%	NA
Tropical Japonica	504	99.40%	0.40%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	80.00%	7.80%	1.11%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320923321	A -> DEL	N	N	silent_mutation	Average:13.679; most accessible tissue: Callus, score: 40.593	N	N	N	N
vg0320923321	A -> G	LOC_Os03g37730.1	upstream_gene_variant ; 260.0bp to feature; MODIFIER	silent_mutation	Average:13.679; most accessible tissue: Callus, score: 40.593	N	N	N	N
vg0320923321	A -> G	LOC_Os03g37736.1	downstream_gene_variant ; 2806.0bp to feature; MODIFIER	silent_mutation	Average:13.679; most accessible tissue: Callus, score: 40.593	N	N	N	N
vg0320923321	A -> G	LOC_Os03g37742.1	downstream_gene_variant ; 4205.0bp to feature; MODIFIER	silent_mutation	Average:13.679; most accessible tissue: Callus, score: 40.593	N	N	N	N
vg0320923321	A -> G	LOC_Os03g37720-LOC_Os03g37730	intergenic_region ; MODIFIER	silent_mutation	Average:13.679; most accessible tissue: Callus, score: 40.593	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320923321	NA	4.99E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320923321	3.02E-06	NA	mr1943	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320923321	NA	3.12E-06	mr1943	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251