\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320911578:

Variant ID: vg0320911578 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20911578
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, C: 0.13, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CTGTTAAGTAAAAATACAATGGTACACACAAAAAAAATAATTCCTCCGTTTCATATTATAAGTCGTTTAACTTTTTTTTCTATTCAAACATTTTTAAGTT[T/C]
AATCAAGTTTATAGAAAAATATAGTAGTATTTTTAACCCAAAACAAACATATTATCAAAATATAATTAATATTTCATTTAATAAAACTAATTTGATATTT

Reverse complement sequence

AAATATCAAATTAGTTTTATTAAATGAAATATTAATTATATTTTGATAATATGTTTGTTTTGGGTTAAAAATACTACTATATTTTTCTATAAACTTGATT[A/G]
AACTTAAAAATGTTTGAATAGAAAAAAAAGTTAAACGACTTATAATATGAAACGGAGGAATTATTTTTTTTGTGTGTACCATTGTATTTTTACTTAACAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 13.80% 0.28% 0.00% NA
All Indica  2759 80.10% 19.60% 0.36% 0.00% NA
All Japonica  1512 93.00% 6.90% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 94.10% 5.90% 0.00% 0.00% NA
Indica II  465 76.60% 23.20% 0.22% 0.00% NA
Indica III  913 69.40% 30.10% 0.44% 0.00% NA
Indica Intermediate  786 83.80% 15.50% 0.64% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 80.60% 19.40% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 2.90% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 1.00% 2.08% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320911578 T -> C LOC_Os03g37710.1 upstream_gene_variant ; 543.0bp to feature; MODIFIER silent_mutation Average:67.495; most accessible tissue: Minghui63 root, score: 90.598 N N N N
vg0320911578 T -> C LOC_Os03g37700.1 downstream_gene_variant ; 3050.0bp to feature; MODIFIER silent_mutation Average:67.495; most accessible tissue: Minghui63 root, score: 90.598 N N N N
vg0320911578 T -> C LOC_Os03g37720.1 downstream_gene_variant ; 2032.0bp to feature; MODIFIER silent_mutation Average:67.495; most accessible tissue: Minghui63 root, score: 90.598 N N N N
vg0320911578 T -> C LOC_Os03g37710-LOC_Os03g37720 intergenic_region ; MODIFIER silent_mutation Average:67.495; most accessible tissue: Minghui63 root, score: 90.598 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320911578 NA 1.18E-09 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320911578 NA 7.09E-07 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320911578 1.61E-10 7.98E-12 mr1439 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320911578 2.22E-06 8.73E-08 mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320911578 NA 1.87E-08 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251