Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0320894743:

Variant ID: vg0320894743 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20894743
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGACCATTCCCACGGAGCTTCTTGAGGCGTTCCTCTACCATCGAGTTGAGGCTAGTAATCTGCTTGACCGTGAGGCCCACAAGGCTAGGGAGGCAGCA[G/A]
TCAAGGCTGTTGAGGAGGAGGAGCTTTGTCTCGAGCTCATCGTTCTCATGCTTTGCCTTATCCACCTTCTCTTGGAGATTGGCGATGCGCTGCTTGAGGA

Reverse complement sequence

TCCTCAAGCAGCGCATCGCCAATCTCCAAGAGAAGGTGGATAAGGCAAAGCATGAGAACGATGAGCTCGAGACAAAGCTCCTCCTCCTCAACAGCCTTGA[C/T]
TGCTGCCTCCCTAGCCTTGTGGGCCTCACGGTCAAGCAGATTACTAGCCTCAACTCGATGGTAGAGGAACGCCTCAAGAAGCTCCGTGGGAATGGTCTCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.60% 32.20% 0.02% 0.19% NA
All Indica  2759 97.60% 2.30% 0.00% 0.14% NA
All Japonica  1512 12.70% 87.20% 0.07% 0.00% NA
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.70% 1.20% 0.00% 0.11% NA
Indica Intermediate  786 95.40% 4.20% 0.00% 0.38% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 33.70% 66.10% 0.20% 0.00% NA
Japonica Intermediate  241 7.90% 92.10% 0.00% 0.00% NA
VI/Aromatic  96 25.00% 75.00% 0.00% 0.00% NA
Intermediate  90 52.20% 42.20% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320894743 G -> A LOC_Os03g37670.1 synonymous_variant ; p.Asp104Asp; LOW synonymous_codon Average:90.041; most accessible tissue: Callus, score: 97.369 N N N N
vg0320894743 G -> DEL LOC_Os03g37670.1 N frameshift_variant Average:90.041; most accessible tissue: Callus, score: 97.369 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0320894743 G A -0.04 -0.03 -0.03 -0.04 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320894743 NA 1.69E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 NA 4.12E-06 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 1.22E-06 5.99E-11 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 8.99E-06 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 8.43E-10 2.27E-20 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 NA 8.66E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 NA 3.90E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 NA 1.01E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 5.19E-06 5.18E-06 mr1987 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 NA 4.61E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 NA 2.45E-11 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 NA 9.34E-08 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 2.39E-06 3.24E-14 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 5.30E-07 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 2.22E-28 3.55E-39 mr1750_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 NA 8.67E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 NA 1.78E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 NA 4.09E-14 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 NA 7.44E-39 mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320894743 NA 1.81E-09 mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251