\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320863559:

Variant ID: vg0320863559 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20863559
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGGCTGTTTTTTAAATTTGCATGGTTATATACCTCTACACTTGTTCTTTATGGATAAGAACAGAGTATCTACACTTGTTCTTTTTTTACGCATAAGAA[T/C]
AGATTTTCTGCACTTGCTCTTTTCTTCTGGATTGATAAGAGAAGACTATCTAGACATGTTGTTTTAGTTAATTTGCCCCTGTTGTTGCTGCCCCTGTGGA

Reverse complement sequence

TCCACAGGGGCAGCAACAACAGGGGCAAATTAACTAAAACAACATGTCTAGATAGTCTTCTCTTATCAATCCAGAAGAAAAGAGCAAGTGCAGAAAATCT[A/G]
TTCTTATGCGTAAAAAAAGAACAAGTGTAGATACTCTGTTCTTATCCATAAAGAACAAGTGTAGAGGTATATAACCATGCAAATTTAAAAAACAGCCCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.20% 0.10% 52.29% 11.38% NA
All Indica  2759 8.10% 0.20% 74.05% 17.62% NA
All Japonica  1512 87.60% 0.00% 10.19% 2.18% NA
Aus  269 13.80% 0.00% 81.78% 4.46% NA
Indica I  595 11.60% 0.30% 67.90% 20.17% NA
Indica II  465 7.70% 0.00% 78.06% 14.19% NA
Indica III  913 4.40% 0.00% 79.19% 16.43% NA
Indica Intermediate  786 10.10% 0.50% 70.36% 19.08% NA
Temperate Japonica  767 99.60% 0.00% 0.13% 0.26% NA
Tropical Japonica  504 67.10% 0.00% 27.18% 5.75% NA
Japonica Intermediate  241 92.50% 0.00% 6.64% 0.83% NA
VI/Aromatic  96 76.00% 0.00% 20.83% 3.12% NA
Intermediate  90 57.80% 0.00% 37.78% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320863559 T -> C LOC_Os03g37620.1 upstream_gene_variant ; 967.0bp to feature; MODIFIER silent_mutation Average:24.267; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 N N N N
vg0320863559 T -> C LOC_Os03g37630.1 upstream_gene_variant ; 529.0bp to feature; MODIFIER silent_mutation Average:24.267; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 N N N N
vg0320863559 T -> C LOC_Os03g37610.1 downstream_gene_variant ; 1812.0bp to feature; MODIFIER silent_mutation Average:24.267; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 N N N N
vg0320863559 T -> C LOC_Os03g37640.1 downstream_gene_variant ; 4766.0bp to feature; MODIFIER silent_mutation Average:24.267; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 N N N N
vg0320863559 T -> C LOC_Os03g37640.2 downstream_gene_variant ; 4766.0bp to feature; MODIFIER silent_mutation Average:24.267; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 N N N N
vg0320863559 T -> C LOC_Os03g37620-LOC_Os03g37630 intergenic_region ; MODIFIER silent_mutation Average:24.267; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 N N N N
vg0320863559 T -> DEL N N silent_mutation Average:24.267; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320863559 NA 3.38E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320863559 NA 1.48E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320863559 1.65E-06 9.52E-10 mr1718 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320863559 NA 3.50E-06 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320863559 NA 2.41E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320863559 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320863559 NA 7.10E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320863559 NA 1.76E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320863559 6.30E-06 2.41E-14 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251