\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320831653:

Variant ID: vg0320831653 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20831653
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGCCTCCAAGGCTCGTAGGACTCCTATTCGGATCTCCATCCGAATTAAGCTCATATTGGATCTCTATCCAATCCCCTTATTCCGGCCCATTAAGCGTGC[A/G]
ACCCTGTAGGTTCATATATACTTGGCTGTAACTCGAAAACTCCTTTTCGGTCCACGCGTCAACAGCATCTCCTAGCAGAACGTATTGACCCACCGGGCAT

Reverse complement sequence

ATGCCCGGTGGGTCAATACGTTCTGCTAGGAGATGCTGTTGACGCGTGGACCGAAAAGGAGTTTTCGAGTTACAGCCAAGTATATATGAACCTACAGGGT[T/C]
GCACGCTTAATGGGCCGGAATAAGGGGATTGGATAGAGATCCAATATGAGCTTAATTCGGATGGAGATCCGAATAGGAGTCCTACGAGCCTTGGAGGCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.30% 35.00% 16.61% 0.06% NA
All Indica  2759 70.70% 6.60% 22.62% 0.07% NA
All Japonica  1512 7.40% 86.40% 6.22% 0.00% NA
Aus  269 64.70% 16.00% 19.33% 0.00% NA
Indica I  595 58.00% 5.20% 36.64% 0.17% NA
Indica II  465 69.70% 6.70% 23.66% 0.00% NA
Indica III  913 80.70% 6.00% 13.14% 0.11% NA
Indica Intermediate  786 69.20% 8.40% 22.39% 0.00% NA
Temperate Japonica  767 0.30% 99.60% 0.13% 0.00% NA
Tropical Japonica  504 19.00% 67.50% 13.49% 0.00% NA
Japonica Intermediate  241 5.80% 83.80% 10.37% 0.00% NA
VI/Aromatic  96 20.80% 76.00% 3.12% 0.00% NA
Intermediate  90 30.00% 55.60% 13.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320831653 A -> DEL N N silent_mutation Average:41.933; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 N N N N
vg0320831653 A -> G LOC_Os03g37554.1 intron_variant ; MODIFIER silent_mutation Average:41.933; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320831653 NA 6.26E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320831653 NA 2.85E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320831653 NA 3.00E-21 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320831653 NA 1.60E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320831653 4.94E-06 3.73E-09 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320831653 2.78E-07 9.61E-12 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320831653 2.08E-07 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320831653 7.54E-12 7.54E-24 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320831653 NA 1.82E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320831653 2.17E-10 2.17E-10 mr1987 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320831653 2.95E-06 2.00E-13 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320831653 3.82E-07 1.62E-24 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320831653 NA 5.79E-14 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251