Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0320822856:

Variant ID: vg0320822856 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20822856
Reference Allele: A	Alternative Allele: G,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACATAAGTGATCGAGGGAAGAGCAAGACCTTCAAGGCGAAACCTCCAAGGAGGTAAACAACGATAGGAGCCGCTGCCGATGCCCGCCCAAAAACTGGACT[A/G,T]
GGTTTTTACCCGAAGGGGAGAGATCCACAAGGCAACACCTCCAAGGAGGAAACGGCACCCGCTGGCGTCGATGTCATCGAACCTGGAAGACCAGGCAAAG

Reverse complement sequence

CTTTGCCTGGTCTTCCAGGTTCGATGACATCGACGCCAGCGGGTGCCGTTTCCTCCTTGGAGGTGTTGCCTTGTGGATCTCTCCCCTTCGGGTAAAAACC[T/C,A]
AGTCCAGTTTTTGGGCGGGCATCGGCAGCGGCTCCTATCGTTGTTTACCTCCTTGGAGGTTTCGCCTTGAAGGTCTTGCTCTTCCCTCGATCACTTATGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.00%	17.90%	0.59%	3.47%	NA
All Indica	2759	99.20%	0.70%	0.04%	0.11%	NA
All Japonica	1512	35.00%	53.10%	1.46%	10.45%	NA
Aus	269	97.80%	1.50%	0.74%	0.00%	NA
Indica I	595	99.30%	0.50%	0.17%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	99.80%	0.00%	0.00%	0.22%	NA
Indica Intermediate	786	99.40%	0.50%	0.00%	0.13%	NA
Temperate Japonica	767	6.90%	92.30%	0.78%	0.00%	NA
Tropical Japonica	504	61.90%	8.90%	0.79%	28.37%	NA
Japonica Intermediate	241	68.00%	20.70%	4.98%	6.22%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	74.40%	18.90%	3.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320822856	A -> T	LOC_Os03g37554.1	downstream_gene_variant ; 3712.0bp to feature; MODIFIER	N	Average:62.133; most accessible tissue: Zhenshan97 young leaf, score: 79.507	N	N	N	N
vg0320822856	A -> T	LOC_Os03g37540.1	intron_variant ; MODIFIER	N	Average:62.133; most accessible tissue: Zhenshan97 young leaf, score: 79.507	N	N	N	N
vg0320822856	A -> DEL	N	N	silent_mutation	Average:62.133; most accessible tissue: Zhenshan97 young leaf, score: 79.507	N	N	N	N
vg0320822856	A -> G	LOC_Os03g37554.1	downstream_gene_variant ; 3712.0bp to feature; MODIFIER	silent_mutation	Average:62.133; most accessible tissue: Zhenshan97 young leaf, score: 79.507	N	N	N	N
vg0320822856	A -> G	LOC_Os03g37540.1	intron_variant ; MODIFIER	silent_mutation	Average:62.133; most accessible tissue: Zhenshan97 young leaf, score: 79.507	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320822856	NA	5.23E-20	Grain_length	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0320822856	NA	1.00E-07	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856	NA	1.22E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856	NA	5.25E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856	NA	1.21E-06	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856	NA	4.98E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856	NA	7.81E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856	NA	1.47E-07	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856	NA	2.46E-22	mr1361_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856	NA	1.12E-16	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856	9.26E-06	NA	mr1718_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856	NA	6.75E-12	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251