\
| Variant ID: vg0320822856 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20822856 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACATAAGTGATCGAGGGAAGAGCAAGACCTTCAAGGCGAAACCTCCAAGGAGGTAAACAACGATAGGAGCCGCTGCCGATGCCCGCCCAAAAACTGGACT[A/G,T]
GGTTTTTACCCGAAGGGGAGAGATCCACAAGGCAACACCTCCAAGGAGGAAACGGCACCCGCTGGCGTCGATGTCATCGAACCTGGAAGACCAGGCAAAG
CTTTGCCTGGTCTTCCAGGTTCGATGACATCGACGCCAGCGGGTGCCGTTTCCTCCTTGGAGGTGTTGCCTTGTGGATCTCTCCCCTTCGGGTAAAAACC[T/C,A]
AGTCCAGTTTTTGGGCGGGCATCGGCAGCGGCTCCTATCGTTGTTTACCTCCTTGGAGGTTTCGCCTTGAAGGTCTTGCTCTTCCCTCGATCACTTATGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.00% | 17.90% | 0.59% | 3.47% | NA |
| All Indica | 2759 | 99.20% | 0.70% | 0.04% | 0.11% | NA |
| All Japonica | 1512 | 35.00% | 53.10% | 1.46% | 10.45% | NA |
| Aus | 269 | 97.80% | 1.50% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 99.40% | 0.50% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 6.90% | 92.30% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 61.90% | 8.90% | 0.79% | 28.37% | NA |
| Japonica Intermediate | 241 | 68.00% | 20.70% | 4.98% | 6.22% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 18.90% | 3.33% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320822856 | A -> T | LOC_Os03g37554.1 | downstream_gene_variant ; 3712.0bp to feature; MODIFIER | N | Average:62.133; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| vg0320822856 | A -> T | LOC_Os03g37540.1 | intron_variant ; MODIFIER | N | Average:62.133; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| vg0320822856 | A -> DEL | N | N | silent_mutation | Average:62.133; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| vg0320822856 | A -> G | LOC_Os03g37554.1 | downstream_gene_variant ; 3712.0bp to feature; MODIFIER | silent_mutation | Average:62.133; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| vg0320822856 | A -> G | LOC_Os03g37540.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.133; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320822856 | NA | 5.23E-20 | Grain_length | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0320822856 | NA | 1.00E-07 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320822856 | NA | 1.22E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320822856 | NA | 5.25E-09 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320822856 | NA | 1.21E-06 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320822856 | NA | 4.98E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320822856 | NA | 7.81E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320822856 | NA | 1.47E-07 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320822856 | NA | 2.46E-22 | mr1361_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320822856 | NA | 1.12E-16 | mr1540_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320822856 | 9.26E-06 | NA | mr1718_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320822856 | NA | 6.75E-12 | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |