\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320822856:

Variant ID: vg0320822856 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20822856
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATAAGTGATCGAGGGAAGAGCAAGACCTTCAAGGCGAAACCTCCAAGGAGGTAAACAACGATAGGAGCCGCTGCCGATGCCCGCCCAAAAACTGGACT[A/G,T]
GGTTTTTACCCGAAGGGGAGAGATCCACAAGGCAACACCTCCAAGGAGGAAACGGCACCCGCTGGCGTCGATGTCATCGAACCTGGAAGACCAGGCAAAG

Reverse complement sequence

CTTTGCCTGGTCTTCCAGGTTCGATGACATCGACGCCAGCGGGTGCCGTTTCCTCCTTGGAGGTGTTGCCTTGTGGATCTCTCCCCTTCGGGTAAAAACC[T/C,A]
AGTCCAGTTTTTGGGCGGGCATCGGCAGCGGCTCCTATCGTTGTTTACCTCCTTGGAGGTTTCGCCTTGAAGGTCTTGCTCTTCCCTCGATCACTTATGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.00% 17.90% 0.59% 3.47% NA
All Indica  2759 99.20% 0.70% 0.04% 0.11% NA
All Japonica  1512 35.00% 53.10% 1.46% 10.45% NA
Aus  269 97.80% 1.50% 0.74% 0.00% NA
Indica I  595 99.30% 0.50% 0.17% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 99.80% 0.00% 0.00% 0.22% NA
Indica Intermediate  786 99.40% 0.50% 0.00% 0.13% NA
Temperate Japonica  767 6.90% 92.30% 0.78% 0.00% NA
Tropical Japonica  504 61.90% 8.90% 0.79% 28.37% NA
Japonica Intermediate  241 68.00% 20.70% 4.98% 6.22% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 74.40% 18.90% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320822856 A -> T LOC_Os03g37554.1 downstream_gene_variant ; 3712.0bp to feature; MODIFIER N Average:62.133; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg0320822856 A -> T LOC_Os03g37540.1 intron_variant ; MODIFIER N Average:62.133; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg0320822856 A -> DEL N N silent_mutation Average:62.133; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg0320822856 A -> G LOC_Os03g37554.1 downstream_gene_variant ; 3712.0bp to feature; MODIFIER silent_mutation Average:62.133; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg0320822856 A -> G LOC_Os03g37540.1 intron_variant ; MODIFIER silent_mutation Average:62.133; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320822856 NA 5.23E-20 Grain_length Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0320822856 NA 1.00E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856 NA 1.22E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856 NA 5.25E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856 NA 1.21E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856 NA 4.98E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856 NA 7.81E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856 NA 1.47E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856 NA 2.46E-22 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856 NA 1.12E-16 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856 9.26E-06 NA mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320822856 NA 6.75E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251