Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320749463:

Variant ID: vg0320749463 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20749463
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.68, G: 0.32, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AGAAATCAGGAAAAGGATGGAAGCATGCACAGAGTTGGTTATAACCGAAACGACAAAATAGACGGGGTTTGGTGATGGCCCCCTTCTACTCTGGGCCCTG[A/G]
ACGGTCGCACAACCGGTCTAGGCCAAGAGCCGGCCCTCTCAATACTATGTTGGCTTTTATTTGAGATACGGAGGGAGGGAGTATATACTCTACACGACAG

Reverse complement sequence

CTGTCGTGTAGAGTATATACTCCCTCCCTCCGTATCTCAAATAAAAGCCAACATAGTATTGAGAGGGCCGGCTCTTGGCCTAGACCGGTTGTGCGACCGT[T/C]
CAGGGCCCAGAGTAGAAGGGGGCCATCACCAAACCCCGTCTATTTTGTCGTTTCGGTTATAACCAACTCTGTGCATGCTTCCATCCTTTTCCTGATTTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.10% 43.70% 0.15% 0.00% NA
All Indica  2759 84.10% 15.80% 0.14% 0.00% NA
All Japonica  1512 1.90% 98.10% 0.07% 0.00% NA
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 95.80% 4.00% 0.17% 0.00% NA
Indica II  465 88.60% 11.40% 0.00% 0.00% NA
Indica III  913 71.20% 28.70% 0.11% 0.00% NA
Indica Intermediate  786 87.40% 12.30% 0.25% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 4.20% 95.60% 0.20% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 45.60% 52.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320749463 A -> G LOC_Os03g37411.1 upstream_gene_variant ; 2145.0bp to feature; MODIFIER silent_mutation Average:74.529; most accessible tissue: Callus, score: 96.509 N N N N
vg0320749463 A -> G LOC_Os03g37411-LOC_Os03g37430 intergenic_region ; MODIFIER silent_mutation Average:74.529; most accessible tissue: Callus, score: 96.509 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0320749463 A G 0.07 0.05 0.01 0.05 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320749463 1.66E-07 5.31E-82 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320749463 2.16E-07 5.60E-11 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320749463 7.10E-10 9.27E-125 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320749463 1.01E-06 1.17E-12 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320749463 NA 6.19E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320749463 2.18E-06 NA mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320749463 2.46E-06 2.46E-06 mr1987 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320749463 NA 1.21E-23 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320749463 NA 6.58E-09 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320749463 2.25E-07 5.41E-116 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320749463 NA 4.31E-14 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320749463 1.48E-08 1.01E-155 mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320749463 NA 8.98E-15 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320749463 NA 4.66E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320749463 NA 8.25E-12 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251