Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320733462:

Variant ID: vg0320733462 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20733462
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 46. )

Flanking Sequence (100 bp) in Reference Genome:

TAAGCTTTCTTGACGCTTACTCCGGCTACCACCAAATCAGCATGGCGAAAGAGGATGAGGAGAAGACAGCATTCATCACGCCGTTCGGGGTATGCTGCTA[C/T]
GTTAAGATGCCGTTCAGACTAATAACTGCAGGAAACACTTTCCAGCGCACGGTCCAAGGTGCACTTAGCAACCAATTAGGAAACAATGTCGAGGCCTACG

Reverse complement sequence

CGTAGGCCTCGACATTGTTTCCTAATTGGTTGCTAAGTGCACCTTGGACCGTGCGCTGGAAAGTGTTTCCTGCAGTTATTAGTCTGAACGGCATCTTAAC[G/A]
TAGCAGCATACCCCGAACGGCGTGATGAATGCTGTCTTCTCCTCATCCTCTTTCGCCATGCTGATTTGGTGGTAGCCGGAGTAAGCGTCAAGAAAGCTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.20%	5.20%	3.66%	55.88%	NA
All Indica	2759	6.30%	3.30%	3.37%	87.02%	NA
All Japonica	1512	87.70%	5.20%	3.37%	3.70%	NA
Aus	269	14.50%	26.00%	5.58%	53.90%	NA
Indica I	595	7.10%	0.30%	2.18%	90.42%	NA
Indica II	465	8.40%	11.00%	8.82%	71.83%	NA
Indica III	913	3.10%	1.10%	1.53%	94.30%	NA
Indica Intermediate	786	8.40%	3.40%	3.18%	84.99%	NA
Temperate Japonica	767	99.70%	0.00%	0.13%	0.13%	NA
Tropical Japonica	504	67.10%	14.90%	9.52%	8.53%	NA
Japonica Intermediate	241	92.50%	1.70%	0.83%	4.98%	NA
VI/Aromatic	96	76.00%	0.00%	10.42%	13.54%	NA
Intermediate	90	56.70%	10.00%	4.44%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320733462	C -> T	LOC_Os03g37411.1	intron_variant ; MODIFIER	silent_mutation	Average:11.8; most accessible tissue: Callus, score: 29.913	N	N	N	N
vg0320733462	C -> DEL	N	N	silent_mutation	Average:11.8; most accessible tissue: Callus, score: 29.913	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320733462	NA	1.95E-06	mr1048	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	NA	3.44E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	4.91E-08	8.42E-11	mr1188	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	3.77E-10	5.56E-13	mr1188	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	NA	1.59E-06	mr1215	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	2.36E-06	NA	mr1218	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	NA	7.08E-07	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	NA	3.59E-07	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	NA	7.62E-07	mr1350	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	4.24E-06	4.23E-06	mr1357	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	NA	4.01E-06	mr1414	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	NA	2.12E-06	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	NA	6.41E-09	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	9.00E-06	1.25E-08	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	7.97E-08	1.45E-08	mr1661	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	NA	8.20E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	8.81E-06	4.22E-07	mr1787	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	NA	2.07E-08	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	NA	6.38E-06	mr1906	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	NA	4.69E-07	mr1124_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	NA	7.86E-08	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	NA	2.51E-07	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	NA	2.74E-07	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462	NA	3.67E-08	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251