\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320733462:

Variant ID: vg0320733462 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20733462
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 46. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGCTTTCTTGACGCTTACTCCGGCTACCACCAAATCAGCATGGCGAAAGAGGATGAGGAGAAGACAGCATTCATCACGCCGTTCGGGGTATGCTGCTA[C/T]
GTTAAGATGCCGTTCAGACTAATAACTGCAGGAAACACTTTCCAGCGCACGGTCCAAGGTGCACTTAGCAACCAATTAGGAAACAATGTCGAGGCCTACG

Reverse complement sequence

CGTAGGCCTCGACATTGTTTCCTAATTGGTTGCTAAGTGCACCTTGGACCGTGCGCTGGAAAGTGTTTCCTGCAGTTATTAGTCTGAACGGCATCTTAAC[G/A]
TAGCAGCATACCCCGAACGGCGTGATGAATGCTGTCTTCTCCTCATCCTCTTTCGCCATGCTGATTTGGTGGTAGCCGGAGTAAGCGTCAAGAAAGCTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.20% 5.20% 3.66% 55.88% NA
All Indica  2759 6.30% 3.30% 3.37% 87.02% NA
All Japonica  1512 87.70% 5.20% 3.37% 3.70% NA
Aus  269 14.50% 26.00% 5.58% 53.90% NA
Indica I  595 7.10% 0.30% 2.18% 90.42% NA
Indica II  465 8.40% 11.00% 8.82% 71.83% NA
Indica III  913 3.10% 1.10% 1.53% 94.30% NA
Indica Intermediate  786 8.40% 3.40% 3.18% 84.99% NA
Temperate Japonica  767 99.70% 0.00% 0.13% 0.13% NA
Tropical Japonica  504 67.10% 14.90% 9.52% 8.53% NA
Japonica Intermediate  241 92.50% 1.70% 0.83% 4.98% NA
VI/Aromatic  96 76.00% 0.00% 10.42% 13.54% NA
Intermediate  90 56.70% 10.00% 4.44% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320733462 C -> T LOC_Os03g37411.1 intron_variant ; MODIFIER silent_mutation Average:11.8; most accessible tissue: Callus, score: 29.913 N N N N
vg0320733462 C -> DEL N N silent_mutation Average:11.8; most accessible tissue: Callus, score: 29.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320733462 NA 1.95E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 NA 3.44E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 4.91E-08 8.42E-11 mr1188 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 3.77E-10 5.56E-13 mr1188 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 NA 1.59E-06 mr1215 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 2.36E-06 NA mr1218 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 NA 7.08E-07 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 NA 3.59E-07 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 NA 7.62E-07 mr1350 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 4.24E-06 4.23E-06 mr1357 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 NA 4.01E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 NA 2.12E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 NA 6.41E-09 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 9.00E-06 1.25E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 7.97E-08 1.45E-08 mr1661 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 NA 8.20E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 8.81E-06 4.22E-07 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 NA 2.07E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 NA 6.38E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 NA 4.69E-07 mr1124_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 NA 7.86E-08 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 NA 2.51E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 NA 2.74E-07 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320733462 NA 3.67E-08 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251