\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320725270:

Variant ID: vg0320725270 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20725270
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTACCCAGGTATATGGGTGGCGATCTAGTCTTAGAATTGGTGGTCCTTAAAACTCTGTGCTTTTGGAGGAGATGGCCAAGGAGTTGTTCATGAGTGG[C/T]
AATTTAGTTGTTAGATTGATGGTCCTCAATACTCCATGTCATTCTTTTTTCCTTTCGAGTGTGGTTTTGTTTGTTCAGTTGTGTGTATCTTAGTTATGCA

Reverse complement sequence

TGCATAACTAAGATACACACAACTGAACAAACAAAACCACACTCGAAAGGAAAAAAGAATGACATGGAGTATTGAGGACCATCAATCTAACAACTAAATT[G/A]
CCACTCATGAACAACTCCTTGGCCATCTCCTCCAAAAGCACAGAGTTTTAAGGACCACCAATTCTAAGACTAGATCGCCACCCATATACCTGGGTAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.90% 15.00% 0.02% 0.00% NA
All Indica  2759 80.50% 19.50% 0.04% 0.00% NA
All Japonica  1512 89.00% 11.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 94.10% 5.90% 0.00% 0.00% NA
Indica II  465 77.00% 23.00% 0.00% 0.00% NA
Indica III  913 69.90% 30.00% 0.11% 0.00% NA
Indica Intermediate  786 84.60% 15.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 70.00% 30.00% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320725270 C -> T LOC_Os03g37394.1 downstream_gene_variant ; 1416.0bp to feature; MODIFIER silent_mutation Average:56.242; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0320725270 C -> T LOC_Os03g37411.1 downstream_gene_variant ; 118.0bp to feature; MODIFIER silent_mutation Average:56.242; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0320725270 C -> T LOC_Os03g37394-LOC_Os03g37411 intergenic_region ; MODIFIER silent_mutation Average:56.242; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320725270 NA 1.93E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320725270 2.38E-09 6.75E-11 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320725270 2.92E-06 4.95E-08 mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320725270 4.70E-06 NA mr1581 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320725270 NA 4.32E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320725270 NA 7.00E-08 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320725270 NA 9.33E-09 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320725270 NA 1.34E-06 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320725270 NA 5.80E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320725270 NA 3.83E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251