Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320725270:

Variant ID: vg0320725270 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20725270
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTACCCAGGTATATGGGTGGCGATCTAGTCTTAGAATTGGTGGTCCTTAAAACTCTGTGCTTTTGGAGGAGATGGCCAAGGAGTTGTTCATGAGTGG[C/T]
AATTTAGTTGTTAGATTGATGGTCCTCAATACTCCATGTCATTCTTTTTTCCTTTCGAGTGTGGTTTTGTTTGTTCAGTTGTGTGTATCTTAGTTATGCA

Reverse complement sequence

TGCATAACTAAGATACACACAACTGAACAAACAAAACCACACTCGAAAGGAAAAAAGAATGACATGGAGTATTGAGGACCATCAATCTAACAACTAAATT[G/A]
CCACTCATGAACAACTCCTTGGCCATCTCCTCCAAAAGCACAGAGTTTTAAGGACCACCAATTCTAAGACTAGATCGCCACCCATATACCTGGGTAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.90%	15.00%	0.02%	0.00%	NA
All Indica	2759	80.50%	19.50%	0.04%	0.00%	NA
All Japonica	1512	89.00%	11.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	94.10%	5.90%	0.00%	0.00%	NA
Indica II	465	77.00%	23.00%	0.00%	0.00%	NA
Indica III	913	69.90%	30.00%	0.11%	0.00%	NA
Indica Intermediate	786	84.60%	15.40%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	70.00%	30.00%	0.00%	0.00%	NA
Japonica Intermediate	241	93.40%	6.60%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320725270	C -> T	LOC_Os03g37394.1	downstream_gene_variant ; 1416.0bp to feature; MODIFIER	silent_mutation	Average:56.242; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0320725270	C -> T	LOC_Os03g37411.1	downstream_gene_variant ; 118.0bp to feature; MODIFIER	silent_mutation	Average:56.242; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0320725270	C -> T	LOC_Os03g37394-LOC_Os03g37411	intergenic_region ; MODIFIER	silent_mutation	Average:56.242; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320725270	NA	1.93E-07	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320725270	2.38E-09	6.75E-11	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320725270	2.92E-06	4.95E-08	mr1439	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320725270	4.70E-06	NA	mr1581	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320725270	NA	4.32E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320725270	NA	7.00E-08	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320725270	NA	9.33E-09	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320725270	NA	1.34E-06	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320725270	NA	5.80E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320725270	NA	3.83E-06	mr1439_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251