Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320635449:

Variant ID: vg0320635449 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20635449
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, A: 0.34, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

CTCGCAGGAATAGGGTTGATCTACACCAGCAAGATCAACAACCCATGAAGAGGTGTATCGATCGCTAAGGCGCAACGCAACGTCATGTACGGTTGTAGTC[G/A]
GGTCGTCAACGTTTCTCTCAAATCGTAGTTATCTCAACTCGCCGAAAGATCGGGCCAATCCTAGCCTTGAGTTTCGAGTGGAACTCAGGGTTCATCACAT

Reverse complement sequence

ATGTGATGAACCCTGAGTTCCACTCGAAACTCAAGGCTAGGATTGGCCCGATCTTTCGGCGAGTTGAGATAACTACGATTTGAGAGAAACGTTGACGACC[C/T]
GACTACAACCGTACATGACGTTGCGTTGCGCCTTAGCGATCGATACACCTCTTCATGGGTTGTTGATCTTGCTGGTGTAGATCAACCCTATTCCTGCGAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.00%	36.20%	0.21%	3.64%	NA
All Indica	2759	90.90%	8.70%	0.18%	0.22%	NA
All Japonica	1512	1.80%	87.40%	0.13%	10.71%	NA
Aus	269	88.80%	11.20%	0.00%	0.00%	NA
Indica I	595	95.60%	4.20%	0.17%	0.00%	NA
Indica II	465	81.50%	18.10%	0.43%	0.00%	NA
Indica III	913	95.60%	4.10%	0.00%	0.33%	NA
Indica Intermediate	786	87.50%	11.80%	0.25%	0.38%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	4.60%	66.10%	0.40%	28.97%	NA
Japonica Intermediate	241	0.80%	92.50%	0.00%	6.64%	NA
VI/Aromatic	96	24.00%	76.00%	0.00%	0.00%	NA
Intermediate	90	40.00%	52.20%	3.33%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320635449	G -> A	LOC_Os03g37240.1	upstream_gene_variant ; 3260.0bp to feature; MODIFIER	silent_mutation	Average:58.596; most accessible tissue: Zhenshan97 young leaf, score: 82.763	N	N	N	N
vg0320635449	G -> A	LOC_Os03g37230.1	downstream_gene_variant ; 3628.0bp to feature; MODIFIER	silent_mutation	Average:58.596; most accessible tissue: Zhenshan97 young leaf, score: 82.763	N	N	N	N
vg0320635449	G -> A	LOC_Os03g37234.1	downstream_gene_variant ; 33.0bp to feature; MODIFIER	silent_mutation	Average:58.596; most accessible tissue: Zhenshan97 young leaf, score: 82.763	N	N	N	N
vg0320635449	G -> A	LOC_Os03g37234-LOC_Os03g37240	intergenic_region ; MODIFIER	silent_mutation	Average:58.596; most accessible tissue: Zhenshan97 young leaf, score: 82.763	N	N	N	N
vg0320635449	G -> DEL	N	N	silent_mutation	Average:58.596; most accessible tissue: Zhenshan97 young leaf, score: 82.763	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320635449	NA	2.90E-08	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449	NA	6.87E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449	NA	8.47E-13	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449	NA	2.06E-21	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449	NA	2.94E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449	NA	5.02E-08	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449	1.16E-06	NA	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449	2.18E-06	4.07E-12	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449	NA	3.55E-08	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449	NA	9.14E-10	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449	NA	2.01E-07	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449	NA	9.42E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449	NA	2.45E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449	2.32E-06	2.32E-06	mr1448_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449	NA	9.85E-12	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449	1.62E-07	NA	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449	7.74E-09	6.01E-18	mr1750_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449	NA	1.93E-10	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449	NA	1.61E-07	mr1987_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251