\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320635449:

Variant ID: vg0320635449 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20635449
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, A: 0.34, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


CTCGCAGGAATAGGGTTGATCTACACCAGCAAGATCAACAACCCATGAAGAGGTGTATCGATCGCTAAGGCGCAACGCAACGTCATGTACGGTTGTAGTC[G/A]
GGTCGTCAACGTTTCTCTCAAATCGTAGTTATCTCAACTCGCCGAAAGATCGGGCCAATCCTAGCCTTGAGTTTCGAGTGGAACTCAGGGTTCATCACAT

Reverse complement sequence

ATGTGATGAACCCTGAGTTCCACTCGAAACTCAAGGCTAGGATTGGCCCGATCTTTCGGCGAGTTGAGATAACTACGATTTGAGAGAAACGTTGACGACC[C/T]
GACTACAACCGTACATGACGTTGCGTTGCGCCTTAGCGATCGATACACCTCTTCATGGGTTGTTGATCTTGCTGGTGTAGATCAACCCTATTCCTGCGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 36.20% 0.21% 3.64% NA
All Indica  2759 90.90% 8.70% 0.18% 0.22% NA
All Japonica  1512 1.80% 87.40% 0.13% 10.71% NA
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 95.60% 4.20% 0.17% 0.00% NA
Indica II  465 81.50% 18.10% 0.43% 0.00% NA
Indica III  913 95.60% 4.10% 0.00% 0.33% NA
Indica Intermediate  786 87.50% 11.80% 0.25% 0.38% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 4.60% 66.10% 0.40% 28.97% NA
Japonica Intermediate  241 0.80% 92.50% 0.00% 6.64% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 40.00% 52.20% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320635449 G -> A LOC_Os03g37240.1 upstream_gene_variant ; 3260.0bp to feature; MODIFIER silent_mutation Average:58.596; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N
vg0320635449 G -> A LOC_Os03g37230.1 downstream_gene_variant ; 3628.0bp to feature; MODIFIER silent_mutation Average:58.596; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N
vg0320635449 G -> A LOC_Os03g37234.1 downstream_gene_variant ; 33.0bp to feature; MODIFIER silent_mutation Average:58.596; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N
vg0320635449 G -> A LOC_Os03g37234-LOC_Os03g37240 intergenic_region ; MODIFIER silent_mutation Average:58.596; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N
vg0320635449 G -> DEL N N silent_mutation Average:58.596; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320635449 NA 2.90E-08 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449 NA 6.87E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449 NA 8.47E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449 NA 2.06E-21 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449 NA 2.94E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449 NA 5.02E-08 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449 1.16E-06 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449 2.18E-06 4.07E-12 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449 NA 3.55E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449 NA 9.14E-10 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449 NA 2.01E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449 NA 9.42E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449 NA 2.45E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449 2.32E-06 2.32E-06 mr1448_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449 NA 9.85E-12 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449 1.62E-07 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449 7.74E-09 6.01E-18 mr1750_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449 NA 1.93E-10 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320635449 NA 1.61E-07 mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251