Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320632634:

Variant ID: vg0320632634 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20632634
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

ATGCAAGGAGACCCCCCAATTCGAATGTTCCTAAGTGCAAAAATCATCGAAGGTGATTAGACTAGGTTTTTCACTTTCGAAATTGAGTTTAGGAAAAACC[G/A]
TACTATTAAGAGGGGTTTCAAGTGTGGTTCTAGGGTATACAAAGTGCTCTTAGTCTTATCCATGAGTCAAAAGATTTTTGGAATCATTTTTGAAAAATGA

Reverse complement sequence

TCATTTTTCAAAAATGATTCCAAAAATCTTTTGACTCATGGATAAGACTAAGAGCACTTTGTATACCCTAGAACCACACTTGAAACCCCTCTTAATAGTA[C/T]
GGTTTTTCCTAAACTCAATTTCGAAAGTGAAAAACCTAGTCTAATCACCTTCGATGATTTTTGCACTTAGGAACATTCGAATTGGGGGGTCTCCTTGCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.80%	24.00%	6.67%	6.56%	NA
All Indica	2759	51.20%	32.80%	9.39%	6.63%	NA
All Japonica	1512	88.50%	1.00%	2.78%	7.74%	NA
Aus	269	25.70%	69.10%	4.46%	0.74%	NA
Indica I	595	32.40%	46.20%	10.92%	10.42%	NA
Indica II	465	58.70%	27.70%	9.68%	3.87%	NA
Indica III	913	52.70%	31.90%	8.00%	7.45%	NA
Indica Intermediate	786	59.20%	26.70%	9.67%	4.45%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	69.00%	2.80%	7.34%	20.83%	NA
Japonica Intermediate	241	92.90%	0.40%	1.66%	4.98%	NA
VI/Aromatic	96	80.20%	19.80%	0.00%	0.00%	NA
Intermediate	90	78.90%	10.00%	2.22%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320632634	G -> A	LOC_Os03g37234.1	upstream_gene_variant ; 2152.0bp to feature; MODIFIER	silent_mutation	Average:21.619; most accessible tissue: Zhenshan97 flag leaf, score: 40.929	N	N	N	N
vg0320632634	G -> A	LOC_Os03g37230.1	downstream_gene_variant ; 813.0bp to feature; MODIFIER	silent_mutation	Average:21.619; most accessible tissue: Zhenshan97 flag leaf, score: 40.929	N	N	N	N
vg0320632634	G -> A	LOC_Os03g37230-LOC_Os03g37234	intergenic_region ; MODIFIER	silent_mutation	Average:21.619; most accessible tissue: Zhenshan97 flag leaf, score: 40.929	N	N	N	N
vg0320632634	G -> DEL	N	N	silent_mutation	Average:21.619; most accessible tissue: Zhenshan97 flag leaf, score: 40.929	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320632634	NA	1.61E-08	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320632634	NA	1.73E-06	mr1439	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320632634	NA	3.67E-07	mr1735	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320632634	NA	7.87E-06	mr1735	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320632634	NA	5.02E-07	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320632634	7.69E-07	NA	mr1750_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251