Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320629521:

Variant ID: vg0320629521 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20629521
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTTTATCTTCTAAAATTCATAAGTAATTCATCCGAGCTCCGTTTAAGTCCATTCAAGTCTCAGTAAATTCATAAAAATCCCTAGAATCCATTAAAAAT[G/A]
GTTTGGTTTTCTGTTTCAGTAGTCTTATATCATGTTTTGCTTGTGTGCTTTGTTTGTCGCGTAGATTTCGGCCGTTTCGTCGATCCGCGGTTTCTCGAAG

Reverse complement sequence

CTTCGAGAAACCGCGGATCGACGAAACGGCCGAAATCTACGCGACAAACAAAGCACACAAGCAAAACATGATATAAGACTACTGAAACAGAAAACCAAAC[C/T]
ATTTTTAATGGATTCTAGGGATTTTTATGAATTTACTGAGACTTGAATGGACTTAAACGGAGCTCGGATGAATTACTTATGAATTTTAGAAGATAAACTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.80%	32.50%	0.17%	3.49%	NA
All Indica	2759	97.50%	2.20%	0.14%	0.11%	NA
All Japonica	1512	1.90%	87.60%	0.07%	10.52%	NA
Aus	269	87.40%	12.60%	0.00%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	98.60%	1.10%	0.11%	0.22%	NA
Indica Intermediate	786	95.50%	3.90%	0.38%	0.13%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	4.80%	66.70%	0.20%	28.37%	NA
Japonica Intermediate	241	0.80%	92.50%	0.00%	6.64%	NA
VI/Aromatic	96	24.00%	76.00%	0.00%	0.00%	NA
Intermediate	90	43.30%	50.00%	3.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320629521	G -> A	LOC_Os03g37230.1	upstream_gene_variant ; 477.0bp to feature; MODIFIER	silent_mutation	Average:55.474; most accessible tissue: Minghui63 young leaf, score: 74.514	N	N	N	N
vg0320629521	G -> A	LOC_Os03g37210.1	downstream_gene_variant ; 1986.0bp to feature; MODIFIER	silent_mutation	Average:55.474; most accessible tissue: Minghui63 young leaf, score: 74.514	N	N	N	N
vg0320629521	G -> A	LOC_Os03g37210-LOC_Os03g37230	intergenic_region ; MODIFIER	silent_mutation	Average:55.474; most accessible tissue: Minghui63 young leaf, score: 74.514	N	N	N	N
vg0320629521	G -> DEL	N	N	silent_mutation	Average:55.474; most accessible tissue: Minghui63 young leaf, score: 74.514	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320629521	9.79E-06	3.25E-06	mr1456	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320629521	6.08E-07	2.43E-10	mr1718	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320629521	2.14E-06	1.30E-114	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320629521	1.21E-06	2.29E-14	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320629521	NA	6.16E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320629521	1.62E-10	3.06E-153	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320629521	1.02E-12	5.17E-27	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320629521	NA	1.41E-07	mr1987_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251