\
| Variant ID: vg0320629521 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20629521 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 177. )
TAGTTTATCTTCTAAAATTCATAAGTAATTCATCCGAGCTCCGTTTAAGTCCATTCAAGTCTCAGTAAATTCATAAAAATCCCTAGAATCCATTAAAAAT[G/A]
GTTTGGTTTTCTGTTTCAGTAGTCTTATATCATGTTTTGCTTGTGTGCTTTGTTTGTCGCGTAGATTTCGGCCGTTTCGTCGATCCGCGGTTTCTCGAAG
CTTCGAGAAACCGCGGATCGACGAAACGGCCGAAATCTACGCGACAAACAAAGCACACAAGCAAAACATGATATAAGACTACTGAAACAGAAAACCAAAC[C/T]
ATTTTTAATGGATTCTAGGGATTTTTATGAATTTACTGAGACTTGAATGGACTTAAACGGAGCTCGGATGAATTACTTATGAATTTTAGAAGATAAACTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.80% | 32.50% | 0.17% | 3.49% | NA |
| All Indica | 2759 | 97.50% | 2.20% | 0.14% | 0.11% | NA |
| All Japonica | 1512 | 1.90% | 87.60% | 0.07% | 10.52% | NA |
| Aus | 269 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.60% | 1.10% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 95.50% | 3.90% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.80% | 66.70% | 0.20% | 28.37% | NA |
| Japonica Intermediate | 241 | 0.80% | 92.50% | 0.00% | 6.64% | NA |
| VI/Aromatic | 96 | 24.00% | 76.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 50.00% | 3.33% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320629521 | G -> A | LOC_Os03g37230.1 | upstream_gene_variant ; 477.0bp to feature; MODIFIER | silent_mutation | Average:55.474; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| vg0320629521 | G -> A | LOC_Os03g37210.1 | downstream_gene_variant ; 1986.0bp to feature; MODIFIER | silent_mutation | Average:55.474; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| vg0320629521 | G -> A | LOC_Os03g37210-LOC_Os03g37230 | intergenic_region ; MODIFIER | silent_mutation | Average:55.474; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| vg0320629521 | G -> DEL | N | N | silent_mutation | Average:55.474; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320629521 | 9.79E-06 | 3.25E-06 | mr1456 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320629521 | 6.08E-07 | 2.43E-10 | mr1718 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320629521 | 2.14E-06 | 1.30E-114 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320629521 | 1.21E-06 | 2.29E-14 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320629521 | NA | 6.16E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320629521 | 1.62E-10 | 3.06E-153 | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320629521 | 1.02E-12 | 5.17E-27 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320629521 | NA | 1.41E-07 | mr1987_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |