\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320629521:

Variant ID: vg0320629521 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20629521
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTTTATCTTCTAAAATTCATAAGTAATTCATCCGAGCTCCGTTTAAGTCCATTCAAGTCTCAGTAAATTCATAAAAATCCCTAGAATCCATTAAAAAT[G/A]
GTTTGGTTTTCTGTTTCAGTAGTCTTATATCATGTTTTGCTTGTGTGCTTTGTTTGTCGCGTAGATTTCGGCCGTTTCGTCGATCCGCGGTTTCTCGAAG

Reverse complement sequence

CTTCGAGAAACCGCGGATCGACGAAACGGCCGAAATCTACGCGACAAACAAAGCACACAAGCAAAACATGATATAAGACTACTGAAACAGAAAACCAAAC[C/T]
ATTTTTAATGGATTCTAGGGATTTTTATGAATTTACTGAGACTTGAATGGACTTAAACGGAGCTCGGATGAATTACTTATGAATTTTAGAAGATAAACTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.80% 32.50% 0.17% 3.49% NA
All Indica  2759 97.50% 2.20% 0.14% 0.11% NA
All Japonica  1512 1.90% 87.60% 0.07% 10.52% NA
Aus  269 87.40% 12.60% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.60% 1.10% 0.11% 0.22% NA
Indica Intermediate  786 95.50% 3.90% 0.38% 0.13% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 4.80% 66.70% 0.20% 28.37% NA
Japonica Intermediate  241 0.80% 92.50% 0.00% 6.64% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 43.30% 50.00% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320629521 G -> A LOC_Os03g37230.1 upstream_gene_variant ; 477.0bp to feature; MODIFIER silent_mutation Average:55.474; most accessible tissue: Minghui63 young leaf, score: 74.514 N N N N
vg0320629521 G -> A LOC_Os03g37210.1 downstream_gene_variant ; 1986.0bp to feature; MODIFIER silent_mutation Average:55.474; most accessible tissue: Minghui63 young leaf, score: 74.514 N N N N
vg0320629521 G -> A LOC_Os03g37210-LOC_Os03g37230 intergenic_region ; MODIFIER silent_mutation Average:55.474; most accessible tissue: Minghui63 young leaf, score: 74.514 N N N N
vg0320629521 G -> DEL N N silent_mutation Average:55.474; most accessible tissue: Minghui63 young leaf, score: 74.514 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320629521 9.79E-06 3.25E-06 mr1456 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320629521 6.08E-07 2.43E-10 mr1718 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320629521 2.14E-06 1.30E-114 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320629521 1.21E-06 2.29E-14 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320629521 NA 6.16E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320629521 1.62E-10 3.06E-153 mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320629521 1.02E-12 5.17E-27 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320629521 NA 1.41E-07 mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251