\
| Variant ID: vg0320620607 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20620607 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 204. )
GATGAAGCAAGCAGCAAGGGAACTCCACCACCCAAGGGAGCTACTATACCTTTTGATTATAGCAAACTTACCATTCCTTCTCACAACTTCGTCTCCGTGC[C/A]
TTCCGGGCGTGCTCCTCAATTTGATGGGACATATTATGCCGCTTGGAAGCACAAGATGAAGTTGCATCTAATCTCTTTGCATCCAAATATTTGGAAAGTT
AACTTTCCAAATATTTGGATGCAAAGAGATTAGATGCAACTTCATCTTGTGCTTCCAAGCGGCATAATATGTCCCATCAAATTGAGGAGCACGCCCGGAA[G/T]
GCACGGAGACGAAGTTGTGAGAAGGAATGGTAAGTTTGCTATAATCAAAAGGTATAGTAGCTCCCTTGGGTGGTGGAGTTCCCTTGCTGCTTGCTTCATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.30% | 15.40% | 1.04% | 46.30% | NA |
| All Indica | 2759 | 7.80% | 20.10% | 1.20% | 70.86% | NA |
| All Japonica | 1512 | 87.50% | 10.90% | 0.66% | 0.93% | NA |
| Aus | 269 | 33.80% | 0.00% | 1.86% | 64.31% | NA |
| Indica I | 595 | 5.00% | 5.90% | 2.02% | 87.06% | NA |
| Indica II | 465 | 8.40% | 23.90% | 1.08% | 66.67% | NA |
| Indica III | 913 | 6.50% | 30.70% | 0.55% | 62.32% | NA |
| Indica Intermediate | 786 | 11.20% | 16.40% | 1.40% | 70.99% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 66.50% | 29.60% | 1.98% | 1.98% | NA |
| Japonica Intermediate | 241 | 92.50% | 6.60% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 81.20% | 0.00% | 0.00% | 18.75% | NA |
| Intermediate | 90 | 58.90% | 8.90% | 1.11% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320620607 | C -> A | LOC_Os03g37210.1 | missense_variant ; p.Pro48His; MODERATE | nonsynonymous_codon ; P48H | Average:19.659; most accessible tissue: Minghui63 young leaf, score: 44.63 | probably damaging |
3.126 |
DELETERIOUS | 0.03 |
| vg0320620607 | C -> DEL | LOC_Os03g37210.1 | N | frameshift_variant | Average:19.659; most accessible tissue: Minghui63 young leaf, score: 44.63 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320620607 | NA | 6.13E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320620607 | NA | 5.48E-09 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320620607 | NA | 3.24E-06 | mr1227 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320620607 | 2.89E-10 | 8.55E-12 | mr1439 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320620607 | 2.33E-06 | 2.29E-08 | mr1439 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320620607 | 4.84E-06 | 4.84E-06 | mr1494 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320620607 | NA | 3.93E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320620607 | 1.39E-06 | NA | mr1836 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320620607 | 4.70E-06 | 4.70E-06 | mr1836 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320620607 | NA | 4.88E-08 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320620607 | 2.62E-07 | 2.30E-09 | mr1852 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320620607 | NA | 2.02E-08 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320620607 | NA | 8.95E-09 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |