\
| Variant ID: vg0320597030 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20597030 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 291. )
AACAAGTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAGCAAGAACTCGTCGAAATAAAACTAAAGCAAAAAGGGTGGCGATGCGC[C/T,A]
GAGATTGTATTGAACGTGTGTGTTAATTGATTACATGGGGTTTGGGGTCTATTTATACCCGAAAATTACAAACTATGTCCATATCGGACACAACTCTTAT
ATAAGAGTTGTGTCCGATATGGACATAGTTTGTAATTTTCGGGTATAAATAGACCCCAAACCCCATGTAATCAATTAACACACACGTTCAATACAATCTC[G/A,T]
GCGCATCGCCACCCTTTTTGCTTTAGTTTTATTTCGACGAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAACTTGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.10% | 3.20% | 0.30% | 3.34% | NA |
| All Indica | 2759 | 88.80% | 5.30% | 0.25% | 5.62% | NA |
| All Japonica | 1512 | 99.50% | 0.10% | 0.46% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 62.40% | 18.70% | 0.84% | 18.15% | NA |
| Indica II | 465 | 96.30% | 1.30% | 0.00% | 2.37% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 91.50% | 3.80% | 0.25% | 4.45% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 0.20% | 1.39% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 2.20% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320597030 | C -> T | LOC_Os03g37140.1 | upstream_gene_variant ; 3607.0bp to feature; MODIFIER | silent_mutation | Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| vg0320597030 | C -> T | LOC_Os03g37170.1 | upstream_gene_variant ; 1856.0bp to feature; MODIFIER | silent_mutation | Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| vg0320597030 | C -> T | LOC_Os03g37180.1 | upstream_gene_variant ; 1128.0bp to feature; MODIFIER | silent_mutation | Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| vg0320597030 | C -> T | LOC_Os03g37194.1 | downstream_gene_variant ; 4521.0bp to feature; MODIFIER | silent_mutation | Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| vg0320597030 | C -> T | LOC_Os03g37170-LOC_Os03g37180 | intergenic_region ; MODIFIER | silent_mutation | Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| vg0320597030 | C -> A | LOC_Os03g37140.1 | upstream_gene_variant ; 3607.0bp to feature; MODIFIER | N | Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| vg0320597030 | C -> A | LOC_Os03g37170.1 | upstream_gene_variant ; 1856.0bp to feature; MODIFIER | N | Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| vg0320597030 | C -> A | LOC_Os03g37180.1 | upstream_gene_variant ; 1128.0bp to feature; MODIFIER | N | Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| vg0320597030 | C -> A | LOC_Os03g37194.1 | downstream_gene_variant ; 4521.0bp to feature; MODIFIER | N | Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| vg0320597030 | C -> A | LOC_Os03g37170-LOC_Os03g37180 | intergenic_region ; MODIFIER | N | Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| vg0320597030 | C -> DEL | N | N | silent_mutation | Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320597030 | NA | 4.11E-07 | Spikelet_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0320597030 | NA | 2.36E-06 | mr1084 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320597030 | NA | 2.36E-07 | mr1106 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320597030 | NA | 3.55E-06 | mr1106 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320597030 | NA | 1.60E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320597030 | NA | 5.67E-06 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320597030 | NA | 2.38E-07 | mr1408 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320597030 | NA | 3.42E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320597030 | 9.08E-06 | 9.08E-06 | mr1506 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320597030 | NA | 9.60E-06 | mr1671 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320597030 | NA | 2.03E-07 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320597030 | NA | 2.92E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320597030 | NA | 4.92E-06 | mr1812 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320597030 | 2.14E-06 | 4.43E-08 | mr1816 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320597030 | NA | 7.79E-07 | mr1816 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320597030 | NA | 1.43E-06 | mr1832 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320597030 | NA | 5.85E-06 | mr1844 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320597030 | 2.46E-06 | 2.46E-06 | mr1845 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320597030 | NA | 5.58E-08 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |