\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320597030:

Variant ID: vg0320597030 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20597030
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


AACAAGTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAGCAAGAACTCGTCGAAATAAAACTAAAGCAAAAAGGGTGGCGATGCGC[C/T,A]
GAGATTGTATTGAACGTGTGTGTTAATTGATTACATGGGGTTTGGGGTCTATTTATACCCGAAAATTACAAACTATGTCCATATCGGACACAACTCTTAT

Reverse complement sequence

ATAAGAGTTGTGTCCGATATGGACATAGTTTGTAATTTTCGGGTATAAATAGACCCCAAACCCCATGTAATCAATTAACACACACGTTCAATACAATCTC[G/A,T]
GCGCATCGCCACCCTTTTTGCTTTAGTTTTATTTCGACGAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAACTTGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 3.20% 0.30% 3.34% NA
All Indica  2759 88.80% 5.30% 0.25% 5.62% NA
All Japonica  1512 99.50% 0.10% 0.46% 0.00% NA
Aus  269 98.90% 0.70% 0.00% 0.37% NA
Indica I  595 62.40% 18.70% 0.84% 18.15% NA
Indica II  465 96.30% 1.30% 0.00% 2.37% NA
Indica III  913 99.90% 0.00% 0.00% 0.11% NA
Indica Intermediate  786 91.50% 3.80% 0.25% 4.45% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 0.20% 1.39% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 2.20% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320597030 C -> T LOC_Os03g37140.1 upstream_gene_variant ; 3607.0bp to feature; MODIFIER silent_mutation Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0320597030 C -> T LOC_Os03g37170.1 upstream_gene_variant ; 1856.0bp to feature; MODIFIER silent_mutation Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0320597030 C -> T LOC_Os03g37180.1 upstream_gene_variant ; 1128.0bp to feature; MODIFIER silent_mutation Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0320597030 C -> T LOC_Os03g37194.1 downstream_gene_variant ; 4521.0bp to feature; MODIFIER silent_mutation Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0320597030 C -> T LOC_Os03g37170-LOC_Os03g37180 intergenic_region ; MODIFIER silent_mutation Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0320597030 C -> A LOC_Os03g37140.1 upstream_gene_variant ; 3607.0bp to feature; MODIFIER N Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0320597030 C -> A LOC_Os03g37170.1 upstream_gene_variant ; 1856.0bp to feature; MODIFIER N Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0320597030 C -> A LOC_Os03g37180.1 upstream_gene_variant ; 1128.0bp to feature; MODIFIER N Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0320597030 C -> A LOC_Os03g37194.1 downstream_gene_variant ; 4521.0bp to feature; MODIFIER N Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0320597030 C -> A LOC_Os03g37170-LOC_Os03g37180 intergenic_region ; MODIFIER N Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0320597030 C -> DEL N N silent_mutation Average:36.438; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320597030 NA 4.11E-07 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0320597030 NA 2.36E-06 mr1084 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320597030 NA 2.36E-07 mr1106 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320597030 NA 3.55E-06 mr1106 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320597030 NA 1.60E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320597030 NA 5.67E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320597030 NA 2.38E-07 mr1408 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320597030 NA 3.42E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320597030 9.08E-06 9.08E-06 mr1506 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320597030 NA 9.60E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320597030 NA 2.03E-07 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320597030 NA 2.92E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320597030 NA 4.92E-06 mr1812 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320597030 2.14E-06 4.43E-08 mr1816 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320597030 NA 7.79E-07 mr1816 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320597030 NA 1.43E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320597030 NA 5.85E-06 mr1844 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320597030 2.46E-06 2.46E-06 mr1845 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320597030 NA 5.58E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251